Mutagenetix > Incidental Mutation

Incidental Mutation 'R1905:Cntnap3'

214321

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

039924-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R1905 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64903764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 26 (V26A)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably benign
Transcript: ENSMUST00000091554
AA Change: V26A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: V26A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Meta Mutation Damage Score

0.0779

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 93.1%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	G	T	13: 119,469,680	V153L	possibly damaging	Het
Adamts17	T	A	7: 67,047,472	C631*	probably null	Het
Adamts19	A	G	18: 59,032,945	R1070G	possibly damaging	Het
Aldh1a1	A	G	19: 20,617,998	E97G	probably damaging	Het
Bola2	T	A	7: 126,696,238	V40E	probably damaging	Het
Ccar1	A	G	10: 62,776,658	S243P	possibly damaging	Het
Cd80	A	T	16: 38,474,177	I141F	probably damaging	Het
Chn2	T	C	6: 54,286,121	C92R	probably damaging	Het
Clk1	A	T	1: 58,421,942		probably benign	Het
Clock	T	C	5: 76,266,888		probably benign	Het
Csf3r	A	T	4: 126,042,745	K651N	probably benign	Het
Cul4a	T	C	8: 13,133,171	M322T	probably benign	Het
Cx3cl1	A	G	8: 94,780,059	T231A	probably benign	Het
Cyp2c68	A	T	19: 39,735,582	C213S	probably benign	Het
Dhx16	T	G	17: 35,888,355	S814A	probably benign	Het
Dnah1	T	C	14: 31,264,630	I3659V	probably benign	Het
Dock6	A	T	9: 21,829,574	V906D	probably benign	Het
Ep400	G	A	5: 110,670,948	T2738I	probably damaging	Het
Erbb4	A	T	1: 68,075,410		probably benign	Het
Fam135b	C	T	15: 71,532,987	R70H	probably damaging	Het
Fam13a	T	C	6: 58,953,490	Q479R	probably damaging	Het
Fam96a	A	G	9: 66,132,647	K82R	probably benign	Het
Fcgr4	A	T	1: 171,029,305	Q247L	probably damaging	Het
Flnc	T	A	6: 29,459,460	C2520S	probably damaging	Het
Foxn1	A	G	11: 78,371,810		probably null	Het
Fsip2	C	T	2: 82,983,428	P3364S	possibly damaging	Het
Fzd8	C	T	18: 9,213,803	T295I	probably damaging	Het
Gm10499	T	C	17: 36,142,941		noncoding transcript	Het
Gm340	A	G	19: 41,583,574	D256G	possibly damaging	Het
Gm4744	G	A	6: 40,951,802		probably benign	Het
Gm4871	G	T	5: 145,030,049	A208D	probably damaging	Het
Gm5155	T	A	7: 17,873,552		noncoding transcript	Het
Gm527	A	G	12: 64,921,023	N73S	possibly damaging	Het
Gm5414	T	C	15: 101,624,640	I451V	probably damaging	Het
Golm1	A	T	13: 59,642,251	V245E	probably benign	Het
Grik1	A	T	16: 87,896,866	Y879*	probably null	Het
Grn	C	A	11: 102,436,450	P241Q	probably damaging	Het
Hjurp	T	C	1: 88,266,616	E190G	probably benign	Het
Hmcn1	A	C	1: 150,992,855	I66S	probably damaging	Het
Hykk	T	A	9: 54,946,383	Y330N	probably benign	Het
Khdc1c	A	G	1: 21,369,057	N89S	probably benign	Het
Lrrc72	T	A	12: 36,208,662		probably null	Het
Lyst	T	G	13: 13,634,134	S130A	probably benign	Het
Mast1	G	A	8: 84,916,266	R967C	probably damaging	Het
Mfng	T	C	15: 78,773,086	T63A	probably damaging	Het
Mre11a	G	A	9: 14,799,627	D206N	probably benign	Het
Myh10	A	G	11: 68,771,868		probably benign	Het
Myt1	A	G	2: 181,797,756	D357G	probably damaging	Het
Nacad	T	A	11: 6,602,540	H217L	probably benign	Het
Ncoa1	A	G	12: 4,295,433	V638A	probably damaging	Het
Nlrp3	T	G	11: 59,549,036	F480V	probably damaging	Het
Nos1ap	A	G	1: 170,318,558	W476R	possibly damaging	Het
Nr1h4	T	A	10: 89,480,559	T220S	possibly damaging	Het
Ntf5	G	T	7: 45,415,752	V103L	probably damaging	Het
Ntm	C	A	9: 29,179,097	D109Y	probably damaging	Het
Olfr18	C	T	9: 20,314,846	E17K	probably benign	Het
P2rx7	G	A	5: 122,680,952	C479Y	probably damaging	Het
Pappa2	T	A	1: 158,803,503		probably null	Het
Pgap1	A	C	1: 54,511,961	I520R	probably benign	Het
Pikfyve	G	A	1: 65,192,295		probably null	Het
Plekhg3	T	C	12: 76,576,217	S744P	probably benign	Het
Pramel6	A	G	2: 87,509,182	R97G	probably damaging	Het
Pramel6	G	T	2: 87,509,183	R97M	probably damaging	Het
Psme4	T	C	11: 30,810,922	V397A	probably damaging	Het
Ptk2b	T	C	14: 66,158,670	D783G	probably damaging	Het
Ptma-ps1	T	A	7: 24,063,881	L17*	probably null	Het
Ralgapa2	C	A	2: 146,387,701	R1053L	probably damaging	Het
Sap130	C	T	18: 31,680,567	P559L	possibly damaging	Het
Sap30	T	C	8: 57,487,311	S86G	probably damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sema3f	G	T	9: 107,684,376	Q500K	probably damaging	Het
Serpinb3d	T	C	1: 107,079,284	I231M	possibly damaging	Het
Sf3a1	T	A	11: 4,176,678	N563K	probably benign	Het
Sipa1l3	A	G	7: 29,339,167	S352P	possibly damaging	Het
Slc6a12	G	T	6: 121,347,443	E9*	probably null	Het
Srebf1	T	C	11: 60,204,493	D400G	probably damaging	Het
Swsap1	T	C	9: 21,956,692	Y87H	probably damaging	Het
Tanc2	G	A	11: 105,922,863	G1711D	possibly damaging	Het
Tas2r107	T	C	6: 131,659,988	M33V	probably benign	Het
Tdrd9	T	A	12: 112,063,627		probably benign	Het
Tdrp	T	C	8: 13,954,079	D86G	probably damaging	Het
Tmem92	A	T	11: 94,778,675	M106K	probably benign	Het
Tmf1	A	T	6: 97,161,479	C764S	possibly damaging	Het
Ttc21a	G	T	9: 119,966,757	R1219L	possibly damaging	Het
Ttn	C	T	2: 76,763,448	G18870D	probably damaging	Het
Tubgcp6	T	C	15: 89,100,608	Y1732C	probably damaging	Het
Vmn1r28	A	G	6: 58,265,927	T252A	probably benign	Het
Xirp2	A	G	2: 67,516,356	I2980M	probably damaging	Het
Zc2hc1c	A	G	12: 85,290,514	D315G	probably benign	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTCTCAGAAGATGAAAGTCTATCG -3'
(R):5'- AGCCTGTGAGTTGCAAGAGG -3'

Sequencing Primer
(F):5'- AATTTTAGTTTTTCAGGTTGCAACTG -3'
(R):5'- CCTGTGAGTTGCAAGAGGAAAGC -3'

Posted On

2014-07-14