Incidental Mutation 'R1905:Aldh1a1'
ID214338
Institutional Source Beutler Lab
Gene Symbol Aldh1a1
Ensembl Gene ENSMUSG00000053279
Gene Namealdehyde dehydrogenase family 1, subfamily A1
SynonymsAhd-2, Ahd2, ALDH1, Raldh1, E1
MMRRC Submission 039924-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.853) question?
Stock #R1905 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location20492715-20643462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20617998 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 97 (E97G)
Ref Sequence ENSEMBL: ENSMUSP00000153011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087638] [ENSMUST00000225313] [ENSMUST00000225337]
Predicted Effect probably damaging
Transcript: ENSMUST00000087638
AA Change: E97G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084918
Gene: ENSMUSG00000053279
AA Change: E97G

DomainStartEndE-ValueType
Pfam:Aldedh 29 492 5.1e-185 PFAM
Pfam:LuxC 147 368 2.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225313
AA Change: E97G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225337
AA Change: E97G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.9326 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aldehyde dehydrogenase family. Aldehyde dehydrogenase is the next enzyme after alcohol dehydrogenase in the major pathway of alcohol metabolism. There are two major aldehyde dehydrogenase isozymes in the liver, cytosolic and mitochondrial, which are encoded by distinct genes, and can be distinguished by their electrophoretic mobility, kinetic properties, and subcellular localization. This gene encodes the cytosolic isozyme. Studies in mice show that through its role in retinol metabolism, this gene may also be involved in the regulation of the metabolic responses to high-fat diet. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene show a significantly reduced ability to convert retinol to retinoic acid in the liver. Retinal morphology is normal even though the gene is normally highly expressed in the dorsal retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,469,680 V153L possibly damaging Het
Adamts17 T A 7: 67,047,472 C631* probably null Het
Adamts19 A G 18: 59,032,945 R1070G possibly damaging Het
Bola2 T A 7: 126,696,238 V40E probably damaging Het
Ccar1 A G 10: 62,776,658 S243P possibly damaging Het
Cd80 A T 16: 38,474,177 I141F probably damaging Het
Chn2 T C 6: 54,286,121 C92R probably damaging Het
Clk1 A T 1: 58,421,942 probably benign Het
Clock T C 5: 76,266,888 probably benign Het
Cntnap3 A G 13: 64,903,764 V26A probably benign Het
Csf3r A T 4: 126,042,745 K651N probably benign Het
Cul4a T C 8: 13,133,171 M322T probably benign Het
Cx3cl1 A G 8: 94,780,059 T231A probably benign Het
Cyp2c68 A T 19: 39,735,582 C213S probably benign Het
Dhx16 T G 17: 35,888,355 S814A probably benign Het
Dnah1 T C 14: 31,264,630 I3659V probably benign Het
Dock6 A T 9: 21,829,574 V906D probably benign Het
Ep400 G A 5: 110,670,948 T2738I probably damaging Het
Erbb4 A T 1: 68,075,410 probably benign Het
Fam135b C T 15: 71,532,987 R70H probably damaging Het
Fam13a T C 6: 58,953,490 Q479R probably damaging Het
Fam96a A G 9: 66,132,647 K82R probably benign Het
Fcgr4 A T 1: 171,029,305 Q247L probably damaging Het
Flnc T A 6: 29,459,460 C2520S probably damaging Het
Foxn1 A G 11: 78,371,810 probably null Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fzd8 C T 18: 9,213,803 T295I probably damaging Het
Gm10499 T C 17: 36,142,941 noncoding transcript Het
Gm340 A G 19: 41,583,574 D256G possibly damaging Het
Gm4744 G A 6: 40,951,802 probably benign Het
Gm4871 G T 5: 145,030,049 A208D probably damaging Het
Gm5155 T A 7: 17,873,552 noncoding transcript Het
Gm527 A G 12: 64,921,023 N73S possibly damaging Het
Gm5414 T C 15: 101,624,640 I451V probably damaging Het
Golm1 A T 13: 59,642,251 V245E probably benign Het
Grik1 A T 16: 87,896,866 Y879* probably null Het
Grn C A 11: 102,436,450 P241Q probably damaging Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hmcn1 A C 1: 150,992,855 I66S probably damaging Het
Hykk T A 9: 54,946,383 Y330N probably benign Het
Khdc1c A G 1: 21,369,057 N89S probably benign Het
Lrrc72 T A 12: 36,208,662 probably null Het
Lyst T G 13: 13,634,134 S130A probably benign Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mfng T C 15: 78,773,086 T63A probably damaging Het
Mre11a G A 9: 14,799,627 D206N probably benign Het
Myh10 A G 11: 68,771,868 probably benign Het
Myt1 A G 2: 181,797,756 D357G probably damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncoa1 A G 12: 4,295,433 V638A probably damaging Het
Nlrp3 T G 11: 59,549,036 F480V probably damaging Het
Nos1ap A G 1: 170,318,558 W476R possibly damaging Het
Nr1h4 T A 10: 89,480,559 T220S possibly damaging Het
Ntf5 G T 7: 45,415,752 V103L probably damaging Het
Ntm C A 9: 29,179,097 D109Y probably damaging Het
Olfr18 C T 9: 20,314,846 E17K probably benign Het
P2rx7 G A 5: 122,680,952 C479Y probably damaging Het
Pappa2 T A 1: 158,803,503 probably null Het
Pgap1 A C 1: 54,511,961 I520R probably benign Het
Pikfyve G A 1: 65,192,295 probably null Het
Plekhg3 T C 12: 76,576,217 S744P probably benign Het
Pramel6 A G 2: 87,509,182 R97G probably damaging Het
Pramel6 G T 2: 87,509,183 R97M probably damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptk2b T C 14: 66,158,670 D783G probably damaging Het
Ptma-ps1 T A 7: 24,063,881 L17* probably null Het
Ralgapa2 C A 2: 146,387,701 R1053L probably damaging Het
Sap130 C T 18: 31,680,567 P559L possibly damaging Het
Sap30 T C 8: 57,487,311 S86G probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3f G T 9: 107,684,376 Q500K probably damaging Het
Serpinb3d T C 1: 107,079,284 I231M possibly damaging Het
Sf3a1 T A 11: 4,176,678 N563K probably benign Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc6a12 G T 6: 121,347,443 E9* probably null Het
Srebf1 T C 11: 60,204,493 D400G probably damaging Het
Swsap1 T C 9: 21,956,692 Y87H probably damaging Het
Tanc2 G A 11: 105,922,863 G1711D possibly damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tdrd9 T A 12: 112,063,627 probably benign Het
Tdrp T C 8: 13,954,079 D86G probably damaging Het
Tmem92 A T 11: 94,778,675 M106K probably benign Het
Tmf1 A T 6: 97,161,479 C764S possibly damaging Het
Ttc21a G T 9: 119,966,757 R1219L possibly damaging Het
Ttn C T 2: 76,763,448 G18870D probably damaging Het
Tubgcp6 T C 15: 89,100,608 Y1732C probably damaging Het
Vmn1r28 A G 6: 58,265,927 T252A probably benign Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Other mutations in Aldh1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Aldh1a1 APN 19 20619997 missense probably benign 0.13
IGL01769:Aldh1a1 APN 19 20642919 missense probably benign 0.29
IGL02745:Aldh1a1 APN 19 20636664 splice site probably benign
IGL02989:Aldh1a1 APN 19 20640058 splice site probably benign
IGL03154:Aldh1a1 APN 19 20630768 missense probably benign 0.21
LCD18:Aldh1a1 UTSW 19 20626646 intron probably benign
R0265:Aldh1a1 UTSW 19 20640076 nonsense probably null
R0282:Aldh1a1 UTSW 19 20629049 splice site probably benign
R0418:Aldh1a1 UTSW 19 20629049 splice site probably benign
R0471:Aldh1a1 UTSW 19 20602013 start codon destroyed probably null 0.99
R0556:Aldh1a1 UTSW 19 20634478 missense probably damaging 1.00
R0755:Aldh1a1 UTSW 19 20617994 missense probably benign
R1164:Aldh1a1 UTSW 19 20617946 missense probably benign 0.11
R1692:Aldh1a1 UTSW 19 20630818 missense probably damaging 1.00
R2127:Aldh1a1 UTSW 19 20642915 missense probably benign 0.00
R2281:Aldh1a1 UTSW 19 20620091 missense possibly damaging 0.88
R2475:Aldh1a1 UTSW 19 20640078 missense probably benign
R3871:Aldh1a1 UTSW 19 20624753 nonsense probably null
R4607:Aldh1a1 UTSW 19 20621687 missense probably benign 0.35
R4725:Aldh1a1 UTSW 19 20640081 missense probably benign
R4791:Aldh1a1 UTSW 19 20619985 missense probably damaging 0.99
R4792:Aldh1a1 UTSW 19 20619985 missense probably damaging 0.99
R4844:Aldh1a1 UTSW 19 20634400 missense probably benign 0.00
R5639:Aldh1a1 UTSW 19 20623422 missense probably damaging 1.00
R5669:Aldh1a1 UTSW 19 20610920 missense probably damaging 1.00
R5815:Aldh1a1 UTSW 19 20630670 missense probably benign 0.00
R6387:Aldh1a1 UTSW 19 20617959 missense probably damaging 0.99
R7078:Aldh1a1 UTSW 19 20602070 missense probably benign
R7282:Aldh1a1 UTSW 19 20629070 missense possibly damaging 0.68
R7334:Aldh1a1 UTSW 19 20621711 missense probably damaging 1.00
R7578:Aldh1a1 UTSW 19 20618002 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCGGGCTAATGGACCTTCTG -3'
(R):5'- TGCTAAGGACTCTGCAAGTTC -3'

Sequencing Primer
(F):5'- GACCTTCTGTTTGTAAGAACTGTC -3'
(R):5'- TCTGCAAGTTCTAGAGAAAACGC -3'
Posted On2014-07-14