Incidental Mutation 'R1906:Adnp'
ID214348
Institutional Source Beutler Lab
Gene Symbol Adnp
Ensembl Gene ENSMUSG00000051149
Gene Nameactivity-dependent neuroprotective protein
SynonymsmKIAA0784
MMRRC Submission 039925-MU
Accession Numbers

Genbank: NM_009628; MGI: 1338758

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1906 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location168180986-168207112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 168182367 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1003 (S1003T)
Ref Sequence ENSEMBL: ENSMUSP00000085316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057793] [ENSMUST00000088001] [ENSMUST00000138667]
Predicted Effect probably benign
Transcript: ENSMUST00000057793
AA Change: S1003T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056809
Gene: ENSMUSG00000051149
AA Change: S1003T

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088001
AA Change: S1003T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085316
Gene: ENSMUSG00000051149
AA Change: S1003T

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138667
SMART Domains Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 240 1.1e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 8.4e-10 PFAM
Pfam:Glycos_transf_2 28 199 3.8e-40 PFAM
Pfam:Glyco_transf_21 87 200 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175182
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a protein family characterized by nine zinc finger motifs followed by a homeobox domain. In vitro studies demonstrate that the encoded protein interacts with the brahma-related gene1-associated or hBRM factors (BAF) gene expression regulating complex, components of the protein translation machinery, and microtubule-associated proteins. This gene has been implicated in neuroprotection through various processes that include chromatin remodeling, splicing, cytoskeletal reorganization, and autophagy. Homozygous mutant knockout mice display embryonic lethality with defects in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Developmental defects including the failure of the cranial neural tube to close lead to embryonic death between E8.5 and E9. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Adnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adnp APN 2 168182562 missense probably benign
IGL00500:Adnp APN 2 168183323 missense possibly damaging 0.85
IGL01604:Adnp APN 2 168184338 missense probably damaging 0.99
IGL01967:Adnp APN 2 168183419 missense possibly damaging 0.85
IGL02470:Adnp APN 2 168183194 missense probably damaging 0.99
C9142:Adnp UTSW 2 168184407 missense probably damaging 0.99
R0893:Adnp UTSW 2 168183727 missense possibly damaging 0.85
R1167:Adnp UTSW 2 168184500 missense probably benign 0.11
R1182:Adnp UTSW 2 168184796 missense possibly damaging 0.77
R1480:Adnp UTSW 2 168183534 missense probably damaging 0.99
R1505:Adnp UTSW 2 168183741 missense possibly damaging 0.93
R3711:Adnp UTSW 2 168184823 missense probably damaging 0.98
R3943:Adnp UTSW 2 168185060 missense possibly damaging 0.92
R4440:Adnp UTSW 2 168184801 missense possibly damaging 0.92
R4686:Adnp UTSW 2 168182389 missense possibly damaging 0.78
R4916:Adnp UTSW 2 168187617 missense possibly damaging 0.91
R5072:Adnp UTSW 2 168183001 missense probably damaging 0.96
R5312:Adnp UTSW 2 168184188 missense probably benign
R5393:Adnp UTSW 2 168182949 missense possibly damaging 0.95
R5598:Adnp UTSW 2 168183725 missense probably damaging 0.99
R6230:Adnp UTSW 2 168182532 missense probably benign
R7165:Adnp UTSW 2 168182367 missense probably benign 0.07
R7176:Adnp UTSW 2 168182658 missense probably benign
R7238:Adnp UTSW 2 168183967 missense probably damaging 1.00
R7254:Adnp UTSW 2 168183998 missense probably damaging 0.99
R7581:Adnp UTSW 2 168183466 missense probably damaging 0.96
R7676:Adnp UTSW 2 168183447 nonsense probably null
R7863:Adnp UTSW 2 168189350 missense possibly damaging 0.91
R8098:Adnp UTSW 2 168182532 missense probably benign
R8196:Adnp UTSW 2 168183172 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCTCACTGTCAATTGTGC -3'
(R):5'- TTTGACTGAGGAACCAGCC -3'

Sequencing Primer
(F):5'- GTCAATTGTGCTATTCTGCCAC -3'
(R):5'- GCCAAATTAATGCATGATGCCTCTG -3'
Posted On2014-07-14