Incidental Mutation 'R1906:Zbtb46'
ID214350
Institutional Source Beutler Lab
Gene Symbol Zbtb46
Ensembl Gene ENSMUSG00000027583
Gene Namezinc finger and BTB domain containing 46
Synonyms2610019F01Rik, Btbd4, 4933406L05Rik
MMRRC Submission 039925-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R1906 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181387762-181459426 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181423839 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 173 (R173W)
Ref Sequence ENSEMBL: ENSMUSP00000137014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029106] [ENSMUST00000087409] [ENSMUST00000155535] [ENSMUST00000180222]
Predicted Effect probably damaging
Transcript: ENSMUST00000029106
AA Change: R173W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029106
Gene: ENSMUSG00000027583
AA Change: R173W

DomainStartEndE-ValueType
BTB 31 129 2.89e-21 SMART
ZnF_C2H2 418 440 4.72e-2 SMART
ZnF_C2H2 446 468 4.24e-4 SMART
ZnF_C2H2 474 498 1.31e2 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087409
AA Change: R173W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084672
Gene: ENSMUSG00000027583
AA Change: R173W

DomainStartEndE-ValueType
BTB 31 129 2.89e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146446
Predicted Effect probably benign
Transcript: ENSMUST00000155535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158987
Predicted Effect probably damaging
Transcript: ENSMUST00000180222
AA Change: R173W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137014
Gene: ENSMUSG00000027583
AA Change: R173W

DomainStartEndE-ValueType
BTB 31 129 2.89e-21 SMART
ZnF_C2H2 418 440 4.72e-2 SMART
ZnF_C2H2 446 468 4.24e-4 SMART
ZnF_C2H2 474 498 1.31e2 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit repressed altered myeloid potential in dendritic cells. Mice homozygous for a different knock-out allele exhibit partial activation of classical dendritic cells in the steady state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Zbtb46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Zbtb46 APN 2 181424135 missense possibly damaging 0.48
IGL02401:Zbtb46 APN 2 181423452 missense probably benign 0.01
R0127:Zbtb46 UTSW 2 181411815 missense probably benign 0.32
R0279:Zbtb46 UTSW 2 181411774 missense possibly damaging 0.67
R1618:Zbtb46 UTSW 2 181424249 missense possibly damaging 0.92
R1711:Zbtb46 UTSW 2 181411684 missense probably damaging 1.00
R1785:Zbtb46 UTSW 2 181391431 missense probably damaging 1.00
R1786:Zbtb46 UTSW 2 181391431 missense probably damaging 1.00
R4170:Zbtb46 UTSW 2 181424355 start codon destroyed probably null 0.98
R4782:Zbtb46 UTSW 2 181391136 missense probably benign
R5656:Zbtb46 UTSW 2 181423417 critical splice donor site probably null
R5808:Zbtb46 UTSW 2 181423570 missense probably benign 0.00
R5932:Zbtb46 UTSW 2 181411920 missense probably benign 0.00
R6360:Zbtb46 UTSW 2 181391455 missense probably damaging 1.00
R6467:Zbtb46 UTSW 2 181391269 missense probably damaging 1.00
R6672:Zbtb46 UTSW 2 181411836 missense probably benign 0.01
R6960:Zbtb46 UTSW 2 181423424 missense probably damaging 0.99
R7485:Zbtb46 UTSW 2 181423719 missense probably benign 0.04
R7780:Zbtb46 UTSW 2 181391432 missense probably damaging 1.00
Z1177:Zbtb46 UTSW 2 181424044 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AAGATGGAAGCTCACTCCCTC -3'
(R):5'- CAGATGACTGACATTGTGCAG -3'

Sequencing Primer
(F):5'- CCCTCCATAATGTGATGGTGAAATC -3'
(R):5'- AGGCCTGCCATGATTTCATCAAG -3'
Posted On2014-07-14