Incidental Mutation 'R1906:Eps15'
ID214357
Institutional Source Beutler Lab
Gene Symbol Eps15
Ensembl Gene ENSMUSG00000028552
Gene Nameepidermal growth factor receptor pathway substrate 15
Synonyms
MMRRC Submission 039925-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1906 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location109280268-109387817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 109324201 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 311 (S311A)
Ref Sequence ENSEMBL: ENSMUSP00000135034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102729] [ENSMUST00000132165] [ENSMUST00000175776] [ENSMUST00000176251]
Predicted Effect probably benign
Transcript: ENSMUST00000102729
AA Change: S311A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099790
Gene: ENSMUSG00000028552
AA Change: S311A

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
internal_repeat_2 622 655 1.25e-5 PROSPERO
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 792 N/A INTRINSIC
internal_repeat_2 799 831 1.25e-5 PROSPERO
UIM 852 871 3.32e0 SMART
UIM 878 897 1.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132165
AA Change: S311A

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118949
Gene: ENSMUSG00000028552
AA Change: S311A

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 429 N/A INTRINSIC
low complexity region 529 552 N/A INTRINSIC
low complexity region 611 621 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
UIM 719 738 3.32e0 SMART
UIM 745 764 1.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175776
AA Change: S347A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135270
Gene: ENSMUSG00000028552
AA Change: S347A

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 253 349 4.38e-48 SMART
EFh 263 291 1.2e1 SMART
EFh 297 325 6.82e1 SMART
coiled coil region 365 538 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
internal_repeat_2 658 691 1.92e-5 PROSPERO
low complexity region 698 721 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 810 828 N/A INTRINSIC
internal_repeat_2 835 867 1.92e-5 PROSPERO
UIM 888 907 3.32e0 SMART
UIM 914 933 1.55e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176251
AA Change: S311A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135034
Gene: ENSMUSG00000028552
AA Change: S311A

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the EGFR pathway. The protein is present at clatherin-coated pits and is involved in receptor-mediated endocytosis of EGF. Notably, this gene is rearranged with the HRX/ALL/MLL gene in acute myelogeneous leukemias. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a null allele show increased marginal zone B cell number with no changes in precursor cells, proliferation, apoptosis, migration or B cell responses. Homozygotes for a different null allele show decreased mean corpuscular hemoglobin (MCH), decreased MCH concentration, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Eps15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Eps15 APN 4 109309149 missense probably damaging 0.99
IGL01372:Eps15 APN 4 109322106 missense probably damaging 1.00
IGL01642:Eps15 APN 4 109366473 missense probably benign 0.00
IGL02207:Eps15 APN 4 109304748 splice site probably benign
IGL02394:Eps15 APN 4 109312965 missense probably damaging 1.00
IGL02755:Eps15 APN 4 109329698 missense probably benign 0.17
R0117:Eps15 UTSW 4 109382819 missense probably damaging 0.96
R0414:Eps15 UTSW 4 109366480 missense probably damaging 0.96
R0928:Eps15 UTSW 4 109312963 missense possibly damaging 0.95
R1545:Eps15 UTSW 4 109312329 missense probably benign 0.00
R1581:Eps15 UTSW 4 109363186 missense probably benign 0.15
R1627:Eps15 UTSW 4 109370557 missense probably damaging 1.00
R1756:Eps15 UTSW 4 109312918 nonsense probably null
R1799:Eps15 UTSW 4 109382837 missense probably damaging 1.00
R1916:Eps15 UTSW 4 109368974 missense probably damaging 1.00
R2042:Eps15 UTSW 4 109304767 missense probably damaging 0.98
R2046:Eps15 UTSW 4 109370596 missense probably damaging 1.00
R2163:Eps15 UTSW 4 109370669 missense probably damaging 0.98
R2213:Eps15 UTSW 4 109361220 missense probably damaging 1.00
R2362:Eps15 UTSW 4 109361230 missense probably benign 0.06
R3151:Eps15 UTSW 4 109366222 missense probably benign 0.02
R3712:Eps15 UTSW 4 109309177 missense probably damaging 1.00
R3727:Eps15 UTSW 4 109370685 splice site probably benign
R4361:Eps15 UTSW 4 109380031 critical splice donor site probably null
R4381:Eps15 UTSW 4 109366530 unclassified probably benign
R4466:Eps15 UTSW 4 109366530 unclassified probably benign
R4740:Eps15 UTSW 4 109343190 missense probably damaging 1.00
R4797:Eps15 UTSW 4 109366530 unclassified probably benign
R4799:Eps15 UTSW 4 109366530 unclassified probably benign
R4801:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4802:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4864:Eps15 UTSW 4 109366530 unclassified probably benign
R4954:Eps15 UTSW 4 109370678 splice site probably null
R5134:Eps15 UTSW 4 109366530 unclassified probably benign
R5386:Eps15 UTSW 4 109321225 missense possibly damaging 0.48
R5768:Eps15 UTSW 4 109363176 splice site probably null
R5870:Eps15 UTSW 4 109361310 missense probably damaging 0.98
R6245:Eps15 UTSW 4 109382866 missense possibly damaging 0.66
R6290:Eps15 UTSW 4 109363198 missense probably benign 0.37
R6291:Eps15 UTSW 4 109305703 frame shift probably null
R6493:Eps15 UTSW 4 109368948 missense probably damaging 1.00
R6813:Eps15 UTSW 4 109280402 splice site probably null
R6885:Eps15 UTSW 4 109309164 missense probably damaging 0.99
R6913:Eps15 UTSW 4 109361230 missense probably benign 0.06
R7362:Eps15 UTSW 4 109366242 critical splice donor site probably null
R7461:Eps15 UTSW 4 109329725 missense probably damaging 1.00
R7613:Eps15 UTSW 4 109329725 missense probably damaging 1.00
R7923:Eps15 UTSW 4 109315872 missense possibly damaging 0.90
R7966:Eps15 UTSW 4 109321143 missense probably damaging 0.98
X0023:Eps15 UTSW 4 109343357 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGTTTTGGGGTTGATAACTAACAC -3'
(R):5'- ACAGTAAAGTGCAGCTGTCATG -3'

Sequencing Primer
(F):5'- GGGGTTGATAACTAACACTATTGTAC -3'
(R):5'- AGTGCAGCTGTCATGAATAATG -3'
Posted On2014-07-14