Incidental Mutation 'R1906:Aass'
ID214366
Institutional Source Beutler Lab
Gene Symbol Aass
Ensembl Gene ENSMUSG00000029695
Gene Nameaminoadipate-semialdehyde synthase
SynonymsLOR/SDH, Lorsdh
MMRRC Submission 039925-MU
Accession Numbers

NCBI RefSeq: NM_013930.4; MGI:1353573

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1906 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location23072173-23132986 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23072985 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 923 (T923I)
Ref Sequence ENSEMBL: ENSMUSP00000031707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031707]
Predicted Effect probably benign
Transcript: ENSMUST00000031707
AA Change: T923I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000031707
Gene: ENSMUSG00000029695
AA Change: T923I

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
AlaDh_PNT_N 27 157 2.76e-22 SMART
AlaDh_PNT_C 197 399 7.94e-23 SMART
Pfam:Sacchrp_dh_NADP 483 598 2.8e-26 PFAM
Pfam:Sacchrp_dh_C 602 916 1.2e-88 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a bifunctional mitochondrial protein that catalyzes the first two steps in the lysine degradation pathway. The N-terminus contains lysine-ketoglutarate reductase activity and converts lysine to saccharopine, whereas the C-terminus contains saccharopine dehydrogenase activity and converts saccharopine to alpha-aminoadipate semialdehyde. Mutations in a human gene encoding a highly similar protein are associated with familial hyperlysinemia. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(10) : Targeted(2) Gene trapped(8

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Aass
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Aass APN 6 23075852 missense probably benign 0.10
IGL01465:Aass APN 6 23114839 critical splice donor site probably null
IGL01617:Aass APN 6 23115150 missense possibly damaging 0.89
IGL01810:Aass APN 6 23107634 missense probably damaging 0.99
IGL02024:Aass APN 6 23113706 missense probably damaging 1.00
IGL02167:Aass APN 6 23122722 intron probably benign
IGL02339:Aass APN 6 23093966 missense probably damaging 0.99
IGL02720:Aass APN 6 23122703 intron probably benign
IGL02877:Aass APN 6 23078876 nonsense probably null
IGL02948:Aass APN 6 23094319 splice site probably benign
PIT4651001:Aass UTSW 6 23118751 missense probably benign 0.00
R0152:Aass UTSW 6 23074689 missense probably damaging 1.00
R0196:Aass UTSW 6 23109520 missense probably damaging 1.00
R0546:Aass UTSW 6 23077077 critical splice donor site probably null
R0841:Aass UTSW 6 23075811 missense probably benign
R0848:Aass UTSW 6 23114985 missense probably damaging 0.98
R0942:Aass UTSW 6 23075152 splice site probably benign
R1082:Aass UTSW 6 23093908 missense probably damaging 1.00
R1159:Aass UTSW 6 23115138 missense probably damaging 0.99
R1730:Aass UTSW 6 23121019 missense probably damaging 1.00
R1818:Aass UTSW 6 23075858 critical splice acceptor site probably null
R2004:Aass UTSW 6 23092562 nonsense probably null
R2191:Aass UTSW 6 23078866 missense possibly damaging 0.91
R3690:Aass UTSW 6 23091329 missense probably benign 0.09
R3843:Aass UTSW 6 23092496 nonsense probably null
R3879:Aass UTSW 6 23122521 missense probably damaging 1.00
R4080:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4081:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4082:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4348:Aass UTSW 6 23113739 missense probably benign 0.03
R4622:Aass UTSW 6 23092330 missense probably damaging 1.00
R4701:Aass UTSW 6 23075856 nonsense probably null
R4823:Aass UTSW 6 23107691 missense probably benign
R5108:Aass UTSW 6 23094208 missense probably damaging 0.99
R5248:Aass UTSW 6 23109438 missense probably benign 0.08
R5481:Aass UTSW 6 23113476 missense probably benign 0.00
R5776:Aass UTSW 6 23107650 missense possibly damaging 0.66
R5883:Aass UTSW 6 23072994 missense probably benign 0.04
R6356:Aass UTSW 6 23093902 missense probably damaging 1.00
R6594:Aass UTSW 6 23113433 missense probably benign 0.00
R6784:Aass UTSW 6 23093896 missense probably null 1.00
R6855:Aass UTSW 6 23114845 missense probably damaging 0.97
R7184:Aass UTSW 6 23094220 missense possibly damaging 0.55
R7208:Aass UTSW 6 23074630 missense probably damaging 0.99
R7464:Aass UTSW 6 23077153 missense possibly damaging 0.69
R7750:Aass UTSW 6 23075200 missense possibly damaging 0.58
R7821:Aass UTSW 6 23120930 missense probably damaging 1.00
R8262:Aass UTSW 6 23107710 missense possibly damaging 0.94
R8303:Aass UTSW 6 23092368 missense probably benign 0.03
R8430:Aass UTSW 6 23078982 missense probably benign 0.01
Z1176:Aass UTSW 6 23078857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGACTTATTAAAGGGTTCTGTG -3'
(R):5'- TACAGTACTGTTTGGCCCTGG -3'

Sequencing Primer
(F):5'- GTCTGGATTCTTCTACTCCAAAAG -3'
(R):5'- GGGTGGGACTCTTGCCATAGAAATAG -3'
Posted On2014-07-14