Incidental Mutation 'R1906:Hyal4'
ID214367
Institutional Source Beutler Lab
Gene Symbol Hyal4
Ensembl Gene ENSMUSG00000029680
Gene Namehyaluronoglucosaminidase 4
Synonyms
MMRRC Submission 039925-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1906 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location24748329-24767662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24756111 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 109 (N109K)
Ref Sequence ENSEMBL: ENSMUSP00000031691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031691]
Predicted Effect probably damaging
Transcript: ENSMUST00000031691
AA Change: N109K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031691
Gene: ENSMUSG00000029680
AA Change: N109K

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Glyco_hydro_56 41 373 3e-137 PFAM
EGF 375 447 2.81e0 SMART
low complexity region 453 473 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar in structure to hyaluronidases. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. However, this protein has not yet been shown to have hyaluronidase activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Hyal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Hyal4 APN 6 24755872 missense probably benign 0.03
IGL01791:Hyal4 APN 6 24763895 splice site probably benign
IGL02434:Hyal4 APN 6 24763858 nonsense probably null
IGL02523:Hyal4 APN 6 24765969 missense probably damaging 0.96
IGL03114:Hyal4 APN 6 24755965 missense probably benign 0.00
IGL02835:Hyal4 UTSW 6 24765715 missense probably benign 0.00
PIT4494001:Hyal4 UTSW 6 24755834 missense probably benign 0.05
R0196:Hyal4 UTSW 6 24756221 missense probably damaging 1.00
R0323:Hyal4 UTSW 6 24756194 missense probably benign 0.30
R0398:Hyal4 UTSW 6 24756671 missense probably damaging 0.97
R0946:Hyal4 UTSW 6 24755913 nonsense probably null
R0961:Hyal4 UTSW 6 24755746 utr 5 prime probably benign
R1998:Hyal4 UTSW 6 24756311 missense probably benign 0.00
R2085:Hyal4 UTSW 6 24755750 start gained probably benign
R2483:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3622:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3623:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3624:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3712:Hyal4 UTSW 6 24756514 missense probably damaging 1.00
R4031:Hyal4 UTSW 6 24756224 missense probably damaging 1.00
R5762:Hyal4 UTSW 6 24765862 missense possibly damaging 0.93
R6177:Hyal4 UTSW 6 24766090 nonsense probably null
R6442:Hyal4 UTSW 6 24765850 missense probably benign 0.08
R6494:Hyal4 UTSW 6 24765746 missense possibly damaging 0.79
R6901:Hyal4 UTSW 6 24756191 missense probably damaging 0.97
R7565:Hyal4 UTSW 6 24765934 missense possibly damaging 0.77
R7973:Hyal4 UTSW 6 24755786 start codon destroyed probably null 0.99
R7977:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R7987:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R8020:Hyal4 UTSW 6 24755996 missense probably benign 0.14
Z1176:Hyal4 UTSW 6 24756628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCAACAGACCTGTGTTTG -3'
(R):5'- GGCTGAATATTCAATATCAGCAGCAG -3'

Sequencing Primer
(F):5'- AGATGGTTGGAAGCCCT -3'
(R):5'- ATCAGCAGCAGATATGTTCTCTTTC -3'
Posted On2014-07-14