Incidental Mutation 'R1906:Ints13'
ID214371
Institutional Source Beutler Lab
Gene Symbol Ints13
Ensembl Gene ENSMUSG00000040250
Gene Nameintegrator complex subunit 13
SynonymsSpata30, 4933424B01Rik, Asun
MMRRC Submission 039925-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1906 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location146549632-146577835 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 146552370 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032427] [ENSMUST00000203545] [ENSMUST00000203545]
Predicted Effect probably null
Transcript: ENSMUST00000032427
SMART Domains Protein: ENSMUSP00000032427
Gene: ENSMUSG00000040250

DomainStartEndE-ValueType
Pfam:DUF2151 4 692 8.2e-292 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131662
SMART Domains Protein: ENSMUSP00000118000
Gene: ENSMUSG00000040250

DomainStartEndE-ValueType
Pfam:DUF2151 1 394 7.2e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139546
Predicted Effect probably null
Transcript: ENSMUST00000139979
SMART Domains Protein: ENSMUSP00000122279
Gene: ENSMUSG00000040250

DomainStartEndE-ValueType
Pfam:DUF2151 2 216 1.6e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152994
Predicted Effect probably null
Transcript: ENSMUST00000203545
SMART Domains Protein: ENSMUSP00000145229
Gene: ENSMUSG00000040250

DomainStartEndE-ValueType
Pfam:DUF2151 1 96 3.8e-48 PFAM
Pfam:DUF2151 94 313 6e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203545
SMART Domains Protein: ENSMUSP00000145229
Gene: ENSMUSG00000040250

DomainStartEndE-ValueType
Pfam:DUF2151 1 96 3.8e-48 PFAM
Pfam:DUF2151 94 313 6e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204234
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Ints13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Ints13 APN 6 146565676 missense probably damaging 1.00
IGL02085:Ints13 APN 6 146549939 utr 3 prime probably benign
IGL02439:Ints13 APN 6 146554223 splice site probably benign
IGL02512:Ints13 APN 6 146576357 missense probably damaging 1.00
IGL02523:Ints13 APN 6 146557611 missense probably benign 0.09
IGL02988:Ints13 APN 6 146556148 missense possibly damaging 0.49
R0083:Ints13 UTSW 6 146550664 missense probably benign 0.06
R0085:Ints13 UTSW 6 146574787 splice site probably benign
R0184:Ints13 UTSW 6 146555044 missense probably benign 0.26
R0656:Ints13 UTSW 6 146552461 missense probably benign 0.19
R1808:Ints13 UTSW 6 146554197 missense probably damaging 1.00
R1838:Ints13 UTSW 6 146566611 missense possibly damaging 0.92
R2140:Ints13 UTSW 6 146576431 missense probably damaging 1.00
R3082:Ints13 UTSW 6 146574707 missense possibly damaging 0.92
R5568:Ints13 UTSW 6 146576357 missense probably damaging 1.00
R5757:Ints13 UTSW 6 146550106 missense probably benign 0.01
R5770:Ints13 UTSW 6 146555073 missense probably damaging 0.98
R5809:Ints13 UTSW 6 146576349 missense probably benign 0.06
R6273:Ints13 UTSW 6 146565681 missense probably damaging 1.00
R6882:Ints13 UTSW 6 146563441 missense probably null 0.18
R6908:Ints13 UTSW 6 146555033 missense probably damaging 0.99
R7089:Ints13 UTSW 6 146574718 missense probably damaging 1.00
R7425:Ints13 UTSW 6 146574700 critical splice donor site probably null
R7660:Ints13 UTSW 6 146557338 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGGCAGTTCTGGGAACATAAGC -3'
(R):5'- CTGGGCCACTTATAGACTTATAAAC -3'

Sequencing Primer
(F):5'- TCTGGGAACATAAGCAGATTTAAGC -3'
(R):5'- ACTAAACTCTGCTTCATTACTTGTTC -3'
Posted On2014-07-14