Incidental Mutation 'R1906:AI987944'
ID214374
Institutional Source Beutler Lab
Gene Symbol AI987944
Ensembl Gene ENSMUSG00000056383
Gene Nameexpressed sequence AI987944
Synonyms
MMRRC Submission 039925-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1906 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location41372923-41393379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41375126 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 146 (R146Q)
Ref Sequence ENSEMBL: ENSMUSP00000145565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071804] [ENSMUST00000205338] [ENSMUST00000206801]
Predicted Effect probably benign
Transcript: ENSMUST00000071804
AA Change: R146Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000071708
Gene: ENSMUSG00000056383
AA Change: R146Q

DomainStartEndE-ValueType
KRAB 4 65 8.72e-15 SMART
ZnF_C2H2 74 96 1.24e2 SMART
ZnF_C2H2 130 152 2.43e-4 SMART
ZnF_C2H2 181 203 5.21e-4 SMART
ZnF_C2H2 209 231 3.95e-4 SMART
ZnF_C2H2 237 259 1.95e-3 SMART
ZnF_C2H2 265 287 4.87e-4 SMART
ZnF_C2H2 293 315 1.72e-4 SMART
ZnF_C2H2 321 343 8.47e-4 SMART
ZnF_C2H2 349 371 9.73e-4 SMART
ZnF_C2H2 377 399 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205338
AA Change: R143Q

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000206801
AA Change: R146Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in AI987944
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03350:AI987944 APN 7 41393237 utr 5 prime probably benign
R0744:AI987944 UTSW 7 41376859 missense probably damaging 1.00
R1083:AI987944 UTSW 7 41375339 missense probably benign 0.09
R1480:AI987944 UTSW 7 41374919 missense probably benign 0.00
R1485:AI987944 UTSW 7 41374530 nonsense probably null
R1491:AI987944 UTSW 7 41374348 nonsense probably null
R1662:AI987944 UTSW 7 41374449 missense possibly damaging 0.79
R1892:AI987944 UTSW 7 41374596 missense probably damaging 1.00
R2037:AI987944 UTSW 7 41374391 missense probably benign 0.04
R2092:AI987944 UTSW 7 41374617 missense possibly damaging 0.58
R2202:AI987944 UTSW 7 41374526 missense probably damaging 0.98
R5070:AI987944 UTSW 7 41375324 missense probably benign 0.23
R5421:AI987944 UTSW 7 41374776 missense probably benign 0.02
R5531:AI987944 UTSW 7 41374390 nonsense probably null
R6822:AI987944 UTSW 7 41374808 missense probably damaging 1.00
R7039:AI987944 UTSW 7 41374456 missense probably benign
R8133:AI987944 UTSW 7 41375065 critical splice donor site probably null
R8228:AI987944 UTSW 7 41376836 missense probably damaging 1.00
R8342:AI987944 UTSW 7 41374886 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACTGTGAACTGCAAAGGCT -3'
(R):5'- GCAGTAAAGCTCTCACATGTTTCAAT -3'

Sequencing Primer
(F):5'- CTGTGAACTGCAAAGGCTTTACC -3'
(R):5'- TATCGCAGTCATCCTCAGAATCATG -3'
Posted On2014-07-14