Incidental Mutation 'R1906:Mast1'
ID214384
Institutional Source Beutler Lab
Gene Symbol Mast1
Ensembl Gene ENSMUSG00000053693
Gene Namemicrotubule associated serine/threonine kinase 1
SynonymsSAST170, SAST, 9430008B02Rik
MMRRC Submission 039925-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1906 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84911903-84937359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84916266 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 967 (R967C)
Ref Sequence ENSEMBL: ENSMUSP00000105363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003910] [ENSMUST00000109741] [ENSMUST00000109744] [ENSMUST00000119820]
Predicted Effect probably benign
Transcript: ENSMUST00000003910
SMART Domains Protein: ENSMUSP00000003910
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 21 349 5.8e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109741
AA Change: R967C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: R967C

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109744
SMART Domains Protein: ENSMUSP00000105366
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
Pfam:DNase_II 9 328 4.8e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119820
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153000
Meta Mutation Damage Score 0.2947 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Mast1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Mast1 APN 8 84912815 missense possibly damaging 0.87
IGL01862:Mast1 APN 8 84913246 intron probably null
IGL01918:Mast1 APN 8 84921209 missense probably damaging 1.00
IGL02212:Mast1 APN 8 84921397 missense probably damaging 1.00
IGL02221:Mast1 APN 8 84918755 missense possibly damaging 0.92
IGL02370:Mast1 APN 8 84912254 missense probably benign
IGL02470:Mast1 APN 8 84921212 missense probably damaging 1.00
IGL02596:Mast1 APN 8 84917771 missense probably benign
IGL02716:Mast1 APN 8 84935723 missense probably damaging 1.00
IGL02987:Mast1 APN 8 84925719 missense possibly damaging 0.75
IGL03287:Mast1 APN 8 84913353 missense probably benign 0.01
R0255:Mast1 UTSW 8 84912021 missense probably benign
R0388:Mast1 UTSW 8 84915537 missense probably benign 0.13
R0480:Mast1 UTSW 8 84913089 missense probably damaging 0.99
R0727:Mast1 UTSW 8 84921415 missense probably damaging 1.00
R1175:Mast1 UTSW 8 84925327 missense probably benign 0.29
R1297:Mast1 UTSW 8 84912716 missense probably benign 0.05
R1328:Mast1 UTSW 8 84917988 intron probably benign
R1454:Mast1 UTSW 8 84920635 missense probably damaging 1.00
R1532:Mast1 UTSW 8 84928609 nonsense probably null
R1752:Mast1 UTSW 8 84925336 missense probably benign
R1777:Mast1 UTSW 8 84912068 missense probably benign
R1905:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R1907:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R2056:Mast1 UTSW 8 84920366 missense possibly damaging 0.95
R2071:Mast1 UTSW 8 84921194 missense probably damaging 1.00
R2145:Mast1 UTSW 8 84921478 missense probably damaging 1.00
R2318:Mast1 UTSW 8 84921125 missense probably damaging 1.00
R2842:Mast1 UTSW 8 84923908 missense probably damaging 1.00
R3870:Mast1 UTSW 8 84918731 missense probably damaging 1.00
R3895:Mast1 UTSW 8 84935723 missense probably damaging 1.00
R3973:Mast1 UTSW 8 84918764 missense probably damaging 1.00
R4405:Mast1 UTSW 8 84920891 missense probably damaging 1.00
R4533:Mast1 UTSW 8 84921361 missense probably damaging 1.00
R4725:Mast1 UTSW 8 84929006 missense possibly damaging 0.93
R4770:Mast1 UTSW 8 84929246 missense probably benign 0.02
R4776:Mast1 UTSW 8 84937193 critical splice donor site probably null
R4835:Mast1 UTSW 8 84923779 missense probably damaging 1.00
R4871:Mast1 UTSW 8 84920658 missense probably damaging 1.00
R4953:Mast1 UTSW 8 84918728 missense probably damaging 0.99
R4960:Mast1 UTSW 8 84917871 missense probably benign
R4978:Mast1 UTSW 8 84935787 missense probably damaging 0.98
R5164:Mast1 UTSW 8 84913518 unclassified probably benign
R5235:Mast1 UTSW 8 84913439 missense probably damaging 1.00
R5297:Mast1 UTSW 8 84913318 critical splice donor site probably null
R5463:Mast1 UTSW 8 84925507 missense probably damaging 1.00
R5546:Mast1 UTSW 8 84916260 missense probably damaging 1.00
R5651:Mast1 UTSW 8 84928968 nonsense probably null
R6124:Mast1 UTSW 8 84925307 missense probably benign 0.01
R6213:Mast1 UTSW 8 84915569 missense probably damaging 1.00
R6717:Mast1 UTSW 8 84917754 missense probably benign
R7000:Mast1 UTSW 8 84928969 missense probably damaging 1.00
R7011:Mast1 UTSW 8 84911945 nonsense probably null
R7164:Mast1 UTSW 8 84935304 missense possibly damaging 0.81
R7695:Mast1 UTSW 8 84920928 missense probably damaging 1.00
X0066:Mast1 UTSW 8 84920878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGAAGCTACTTATGGCCCTAC -3'
(R):5'- AGCAGAGTGTGAGGTTTGCC -3'

Sequencing Primer
(F):5'- AGCCGGAGACCTTTTGTATC -3'
(R):5'- GTGAGGTTTGCCCTGATCTCTAAC -3'
Posted On2014-07-14