Incidental Mutation 'R1906:Lifr'
ID214402
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Nameleukemia inhibitory factor receptor
SynonymsA230075M04Rik, soluble differentiation-stimulating factor receptor
MMRRC Submission 039925-MU
Accession Numbers

Genbank: NM_013584; MGI: 96788  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1906 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location7090614-7197489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7188131 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 847 (V847L)
Ref Sequence ENSEMBL: ENSMUSP00000154750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
Predicted Effect probably damaging
Transcript: ENSMUST00000067190
AA Change: V847L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: V847L

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164529
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171588
AA Change: V847L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: V847L

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226471
AA Change: V847L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000226934
Predicted Effect probably benign
Transcript: ENSMUST00000227727
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7185739 splice site probably null
IGL01470:Lifr APN 15 7175666 nonsense probably null
IGL01489:Lifr APN 15 7175556 splice site probably benign
IGL01619:Lifr APN 15 7191162 missense probably damaging 1.00
IGL01636:Lifr APN 15 7179018 splice site probably benign
IGL01943:Lifr APN 15 7188149 missense probably damaging 1.00
IGL02253:Lifr APN 15 7190604 missense probably damaging 1.00
IGL02355:Lifr APN 15 7164693 critical splice donor site probably null
IGL02362:Lifr APN 15 7164693 critical splice donor site probably null
IGL02450:Lifr APN 15 7190765 missense probably damaging 1.00
IGL02477:Lifr APN 15 7186923 missense probably damaging 1.00
IGL02503:Lifr APN 15 7185623 missense probably damaging 1.00
IGL02571:Lifr APN 15 7190111 unclassified probably benign
IGL03340:Lifr APN 15 7177936 missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7186953 missense possibly damaging 0.80
R0012:Lifr UTSW 15 7175608 missense possibly damaging 0.78
R0015:Lifr UTSW 15 7188186 splice site probably null
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0305:Lifr UTSW 15 7177501 missense probably damaging 0.99
R0416:Lifr UTSW 15 7166914 missense probably damaging 1.00
R0440:Lifr UTSW 15 7157191 nonsense probably null
R0519:Lifr UTSW 15 7177580 missense probably damaging 1.00
R0595:Lifr UTSW 15 7177469 missense probably damaging 1.00
R0601:Lifr UTSW 15 7169272 splice site probably null
R0780:Lifr UTSW 15 7177466 missense probably benign 0.00
R0790:Lifr UTSW 15 7185715 missense probably benign 0.13
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1400:Lifr UTSW 15 7190865 missense probably benign 0.04
R1498:Lifr UTSW 15 7190618 missense probably damaging 0.99
R1785:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R1786:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R2099:Lifr UTSW 15 7157251 missense probably benign
R2102:Lifr UTSW 15 7186923 missense probably damaging 1.00
R2136:Lifr UTSW 15 7181857 missense possibly damaging 0.89
R2511:Lifr UTSW 15 7166916 missense probably benign
R4375:Lifr UTSW 15 7166898 missense probably benign
R4883:Lifr UTSW 15 7185625 missense possibly damaging 0.94
R5681:Lifr UTSW 15 7191084 missense probably damaging 1.00
R5689:Lifr UTSW 15 7184804 missense probably damaging 1.00
R5693:Lifr UTSW 15 7175560 missense probably damaging 1.00
R5902:Lifr UTSW 15 7190750 missense probably benign
R5918:Lifr UTSW 15 7159416 missense probably benign 0.00
R5924:Lifr UTSW 15 7172972 missense probably benign 0.28
R6037:Lifr UTSW 15 7186943 missense probably damaging 1.00
R6037:Lifr UTSW 15 7186943 missense probably damaging 1.00
R6289:Lifr UTSW 15 7166910 missense probably benign 0.00
R6339:Lifr UTSW 15 7167049 missense probably benign 0.01
R6860:Lifr UTSW 15 7172937 missense probably benign 0.02
R7106:Lifr UTSW 15 7172924 missense probably benign 0.02
R7107:Lifr UTSW 15 7178940 missense possibly damaging 0.88
R7274:Lifr UTSW 15 7167059 critical splice donor site probably null
R7625:Lifr UTSW 15 7169242 missense probably damaging 0.99
R7631:Lifr UTSW 15 7184777 missense probably damaging 1.00
R7958:Lifr UTSW 15 7181997 missense possibly damaging 0.62
R7991:Lifr UTSW 15 7173482 missense possibly damaging 0.79
R8175:Lifr UTSW 15 7187015 missense probably damaging 1.00
R8427:Lifr UTSW 15 7190981 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATACTCCAGTGTTGGTGGC -3'
(R):5'- ACAGAAAGGGCTCCACTTTC -3'

Sequencing Primer
(F):5'- CCAGTGTTGGTGGCCCTAGATC -3'
(R):5'- AGGGAGAATGACGGCTTTTACTC -3'
Posted On2014-07-14