Incidental Mutation 'R1906:Rhpn1'
ID214403
Institutional Source Beutler Lab
Gene Symbol Rhpn1
Ensembl Gene ENSMUSG00000022580
Gene Namerhophilin, Rho GTPase binding protein 1
SynonymsGrbp, Rhophilin
MMRRC Submission 039925-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1906 (G1)
Quality Score159
Status Not validated
Chromosome15
Chromosomal Location75704280-75715485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75711824 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 386 (V386A)
Ref Sequence ENSEMBL: ENSMUSP00000116837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023244] [ENSMUST00000121137] [ENSMUST00000149407]
Predicted Effect probably benign
Transcript: ENSMUST00000023244
AA Change: V386A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023244
Gene: ENSMUSG00000022580
AA Change: V386A

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 498 4.31e-147 SMART
PDZ 508 578 9.27e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121137
AA Change: V386A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113042
Gene: ENSMUSG00000022580
AA Change: V386A

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 516 1.64e-161 SMART
PDZ 526 596 9.27e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143056
Predicted Effect probably benign
Transcript: ENSMUST00000149407
AA Change: V386A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000116837
Gene: ENSMUSG00000022580
AA Change: V386A

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 449 7.17e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229843
Meta Mutation Damage Score 0.0930 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Rhpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Rhpn1 APN 15 75711886 missense probably damaging 0.99
IGL02211:Rhpn1 APN 15 75711056 missense possibly damaging 0.94
R0049:Rhpn1 UTSW 15 75709239 missense possibly damaging 0.73
R0049:Rhpn1 UTSW 15 75709239 missense possibly damaging 0.73
R0240:Rhpn1 UTSW 15 75714122 missense probably benign 0.05
R0240:Rhpn1 UTSW 15 75714122 missense probably benign 0.05
R0324:Rhpn1 UTSW 15 75711588 missense probably damaging 0.99
R0426:Rhpn1 UTSW 15 75711872 missense possibly damaging 0.71
R0453:Rhpn1 UTSW 15 75713579 missense possibly damaging 0.93
R0893:Rhpn1 UTSW 15 75711654 missense probably damaging 1.00
R1051:Rhpn1 UTSW 15 75712392 missense probably damaging 0.99
R1571:Rhpn1 UTSW 15 75714118 missense possibly damaging 0.93
R1907:Rhpn1 UTSW 15 75711824 missense probably benign 0.02
R2110:Rhpn1 UTSW 15 75713234 missense probably damaging 1.00
R2153:Rhpn1 UTSW 15 75704394 start codon destroyed probably null 0.00
R3943:Rhpn1 UTSW 15 75711806 missense probably damaging 0.97
R4030:Rhpn1 UTSW 15 75710557 missense probably damaging 1.00
R4552:Rhpn1 UTSW 15 75714119 missense probably benign 0.00
R5015:Rhpn1 UTSW 15 75708241 missense probably damaging 1.00
R5103:Rhpn1 UTSW 15 75714215 missense possibly damaging 0.83
R5121:Rhpn1 UTSW 15 75709260 missense probably damaging 1.00
R5337:Rhpn1 UTSW 15 75708205 missense probably benign
R7324:Rhpn1 UTSW 15 75704397 missense possibly damaging 0.89
R7596:Rhpn1 UTSW 15 75712313 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAGGCTGAGCACTTCTG -3'
(R):5'- AGATTGGGAAAGTCCTGCCAG -3'

Sequencing Primer
(F):5'- CACTTCTGCGCCCTGGC -3'
(R):5'- GTTTAACAACCCTCGTCTCAGCAG -3'
Posted On2014-07-14