Incidental Mutation 'R1906:Krt75'
ID214406
Institutional Source Beutler Lab
Gene Symbol Krt75
Ensembl Gene ENSMUSG00000022986
Gene Namekeratin 75
SynonymsKrt2-6hf, 4732468K03Rik, K6hf, Krtcap1
MMRRC Submission 039925-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1906 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101563345-101573904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101573366 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 156 (T156S)
Ref Sequence ENSEMBL: ENSMUSP00000036246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042957]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042957
AA Change: T156S

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036246
Gene: ENSMUSG00000022986
AA Change: T156S

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 146 1e-32 PFAM
Filament 149 462 1.68e-178 SMART
low complexity region 468 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196179
Meta Mutation Damage Score 0.0960 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. This gene is expressed in the companion layer, upper germinative matrix region of the hair follicle, and medulla of the hair shaft. The encoded protein plays an essential role in hair and nail formation. Variations in this gene have been associated with the hair disorders pseudofolliculitis barbae (PFB) and loose anagen hair syndrome (LAHS). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-in mutation that results in the deletion of the highly conserved asparagine residue (N159) in the helix initiation peptide of this gene develop hair shaft and nail abnormalities resembling pachyonychia congenita. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Krt75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Krt75 APN 15 101572646 missense probably benign
IGL01406:Krt75 APN 15 101568025 missense probably damaging 1.00
IGL01783:Krt75 APN 15 101564929 missense probably benign 0.01
IGL01911:Krt75 APN 15 101568102 missense probably damaging 1.00
IGL01945:Krt75 APN 15 101570164 missense possibly damaging 0.56
IGL02178:Krt75 APN 15 101572791 missense probably benign 0.00
IGL02832:Krt75 APN 15 101568073 missense probably benign 0.02
IGL03173:Krt75 APN 15 101572727 missense probably damaging 1.00
IGL03276:Krt75 APN 15 101568376 missense probably damaging 0.98
BB007:Krt75 UTSW 15 101564883 makesense probably null
BB017:Krt75 UTSW 15 101564883 makesense probably null
R0482:Krt75 UTSW 15 101570311 missense probably benign 0.22
R0595:Krt75 UTSW 15 101568354 missense probably damaging 1.00
R0626:Krt75 UTSW 15 101573590 missense probably benign 0.05
R1495:Krt75 UTSW 15 101573873 start gained probably benign
R1886:Krt75 UTSW 15 101571097 missense probably damaging 0.97
R1907:Krt75 UTSW 15 101573366 missense possibly damaging 0.66
R2055:Krt75 UTSW 15 101572761 missense probably benign 0.08
R2504:Krt75 UTSW 15 101568031 missense probably benign 0.27
R2930:Krt75 UTSW 15 101568031 missense probably benign 0.27
R3788:Krt75 UTSW 15 101573521 missense possibly damaging 0.94
R4494:Krt75 UTSW 15 101571701 nonsense probably null
R4803:Krt75 UTSW 15 101568072 missense probably benign 0.00
R4868:Krt75 UTSW 15 101568121 missense probably damaging 1.00
R4906:Krt75 UTSW 15 101570239 missense probably damaging 1.00
R4969:Krt75 UTSW 15 101573813 missense probably benign
R5069:Krt75 UTSW 15 101566238 critical splice donor site probably null
R5446:Krt75 UTSW 15 101571067 missense probably null 0.22
R6019:Krt75 UTSW 15 101573723 missense probably benign 0.00
R6739:Krt75 UTSW 15 101571068 missense probably benign 0.00
R6835:Krt75 UTSW 15 101571037 missense probably benign 0.16
R7167:Krt75 UTSW 15 101568315 missense possibly damaging 0.90
R7622:Krt75 UTSW 15 101570272 missense probably damaging 1.00
R7930:Krt75 UTSW 15 101564883 makesense probably null
R8046:Krt75 UTSW 15 101572764 missense probably benign 0.01
X0022:Krt75 UTSW 15 101570213 missense possibly damaging 0.94
Z1088:Krt75 UTSW 15 101573665 missense probably benign 0.00
Z1177:Krt75 UTSW 15 101571054 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGATGGCCTGACTTGAGAATGTC -3'
(R):5'- TTTGGTGGCAGGACTAGCAG -3'

Sequencing Primer
(F):5'- CCTGACTTGAGAATGTCCATGG -3'
(R):5'- CTTTGGGGGCAGCAGTG -3'
Posted On2014-07-14