Mutagenetix > Incidental Mutations

Incidental Mutation 'R1906:Adamts5'

214407

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

039925-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.254) question?

Stock #

R1906 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 85868685 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 576 (W576*)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably null
Transcript: ENSMUST00000023611
AA Change: W576*

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: W576*

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 94.9%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	G	A	6: 23,072,985	T923I	probably benign	Het
Abhd13	T	A	8: 9,988,170	C256S	probably benign	Het
Adnp	A	T	2: 168,182,367	S1003T	probably benign	Het
AI987944	C	T	7: 41,375,126	R146Q	probably benign	Het
Apol6	G	T	15: 77,050,860	V110F	probably damaging	Het
Arhgap27	A	G	11: 103,332,925	F651L	probably damaging	Het
Atm	T	C	9: 53,506,568	D813G	probably damaging	Het
Casd1	T	A	6: 4,641,979	I752N	probably damaging	Het
Cdr2	A	G	7: 120,982,001	Y18H	probably damaging	Het
Cntn4	T	C	6: 106,353,646	F75S	probably benign	Het
Col20a1	G	A	2: 180,998,697	R549H	probably benign	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Ddx58	T	C	4: 40,206,054	K846R	probably benign	Het
Dnah10	T	A	5: 124,800,984	V2654D	probably damaging	Het
Dnph1	A	T	17: 46,496,861	I18F	probably damaging	Het
Dsn1	G	A	2: 156,996,243	R334W	probably damaging	Het
Egf	T	A	3: 129,725,224	K325N	probably benign	Het
Eps15	T	G	4: 109,324,201	S311A	possibly damaging	Het
Fmo3	G	T	1: 162,966,906	D198E	probably damaging	Het
Folh1	C	G	7: 86,742,166		probably null	Het
Foxn1	A	G	11: 78,371,810		probably null	Het
Gm10604	T	G	4: 11,979,989	D105A	unknown	Het
Gpx8	A	G	13: 113,045,576	C108R	probably damaging	Het
Herc2	A	T	7: 56,114,864	I1013L	probably benign	Het
Hyal4	T	G	6: 24,756,111	N109K	probably damaging	Het
Il22ra1	T	G	4: 135,751,233	C538W	probably damaging	Het
Ints13	A	T	6: 146,552,370		probably null	Het
Krt75	T	A	15: 101,573,366	T156S	possibly damaging	Het
Lama2	A	C	10: 27,056,527		probably null	Het
Lifr	G	T	15: 7,188,131	V847L	probably damaging	Het
Lmf1	T	A	17: 25,612,335	I185N	probably damaging	Het
Mast1	G	A	8: 84,916,266	R967C	probably damaging	Het
Ms4a15	T	C	19: 10,983,280	I94V	probably benign	Het
Mycbpap	A	T	11: 94,505,621	M131K	probably benign	Het
Ncor1	A	T	11: 62,349,385	M920K	possibly damaging	Het
Neb	A	G	2: 52,308,526	Y437H	probably damaging	Het
Npy5r	A	T	8: 66,681,473	W223R	probably damaging	Het
Olfr1219	A	G	2: 89,075,070	V7A	possibly damaging	Het
Olfr1333	G	A	4: 118,830,270	H56Y	probably damaging	Het
Olfr248	C	A	1: 174,391,164	L32M	probably damaging	Het
Olfr804	T	G	10: 129,705,496	V206G	probably benign	Het
Polg	T	C	7: 79,460,322	K353E	probably damaging	Het
Proz	C	G	8: 13,073,686		probably null	Het
Pus7	T	C	5: 23,778,211	D86G	probably damaging	Het
Rhpn1	T	C	15: 75,711,824	V386A	probably benign	Het
Sptbn4	A	G	7: 27,391,431		probably null	Het
Srp68	A	T	11: 116,250,761	I424N	probably damaging	Het
Stard9	A	G	2: 120,696,427	E1055G	probably benign	Het
Taf4b	A	G	18: 14,822,102	I571V	probably benign	Het
Tas2r107	T	C	6: 131,659,988	M33V	probably benign	Het
Thap12	T	C	7: 98,716,740	L705P	probably damaging	Het
Tom1	T	C	8: 75,051,590	V100A	probably damaging	Het
Tox3	A	G	8: 90,248,429		probably benign	Het
Vmn2r82	A	G	10: 79,396,510	N781S	probably damaging	Het
Vwa5b1	A	T	4: 138,600,236	V343E	possibly damaging	Het
Zbbx	A	G	3: 75,071,740	Y467H	probably damaging	Het
Zbtb46	G	A	2: 181,423,839	R173W	probably damaging	Het
Zfp112	A	G	7: 24,122,295	D20G	probably benign	Het
Zfp777	A	C	6: 48,042,061	M313R	probably damaging	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATGACATATGTGATTACTGACAC -3'
(R):5'- TGTGCTGCTAGAAATGAGGTCC -3'

Sequencing Primer
(F):5'- TGATTACTGACACCTGAGGGC -3'
(R):5'- GGTCCTGAATAATGATGACCTGC -3'

Posted On

2014-07-14