Mutagenetix > Incidental Mutations

Incidental Mutation 'R1907:Stard9'

214430

Institutional Source

Beutler Lab

Gene Symbol

Stard9

Ensembl Gene

ENSMUSG00000033705

Gene Name

START domain containing 9

Synonyms

E230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin

MMRRC Submission

039926-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.265) question?

Stock #

R1907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120629121-120731895 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 120713812 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 4471 (V4471L)

Ref Sequence

ENSEMBL: ENSMUSP00000136055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]

Predicted Effect

probably benign
Transcript: ENSMUST00000070420

SMART Domains

Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
coiled coil region	97	138	N/A	INTRINSIC
low complexity region	142	151	N/A	INTRINSIC
low complexity region	157	174	N/A	INTRINSIC
low complexity region	234	255	N/A	INTRINSIC
Pfam:START	274	469	3.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110700

SMART Domains

Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284

Domain	Start	End	E-Value	Type
low complexity region	25	42	N/A	INTRINSIC
low complexity region	78	99	N/A	INTRINSIC
low complexity region	102	151	N/A	INTRINSIC
low complexity region	154	180	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	786	906	2.4e-48	PFAM
low complexity region	1157	1171	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110701

SMART Domains

Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284

Domain	Start	End	E-Value	Type
low complexity region	77	98	N/A	INTRINSIC
low complexity region	101	150	N/A	INTRINSIC
low complexity region	153	179	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	789	904	2.4e-41	PFAM
low complexity region	1164	1178	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129384

Predicted Effect

probably benign
Transcript: ENSMUST00000140843

SMART Domains

Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
FHA	63	115	2.8e-4	SMART
coiled coil region	334	354	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	866	871	N/A	INTRINSIC
low complexity region	1023	1035	N/A	INTRINSIC
low complexity region	1234	1248	N/A	INTRINSIC
low complexity region	1765	1775	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2953	2963	N/A	INTRINSIC
low complexity region	3269	3281	N/A	INTRINSIC
low complexity region	3421	3435	N/A	INTRINSIC
coiled coil region	3767	3808	N/A	INTRINSIC
low complexity region	3812	3821	N/A	INTRINSIC
low complexity region	3827	3844	N/A	INTRINSIC
low complexity region	3904	3925	N/A	INTRINSIC
SCOP:d1jssa_	3946	4142	1e-28	SMART
Blast:START	3947	4143	1e-10	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141917

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148285

Predicted Effect

possibly damaging
Transcript: ENSMUST00000154193
AA Change: V695L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705
AA Change: V695L

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
coiled coil region	409	450	N/A	INTRINSIC
low complexity region	454	463	N/A	INTRINSIC
low complexity region	469	486	N/A	INTRINSIC
low complexity region	546	567	N/A	INTRINSIC
SCOP:d1jssa_	588	784	4e-29	SMART
Blast:START	589	785	6e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000180041
AA Change: V4471L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: V4471L

Domain	Start	End	E-Value	Type
KISc	1	392	3.31e-143	SMART
low complexity region	398	409	N/A	INTRINSIC
FHA	481	533	2.8e-4	SMART
coiled coil region	752	772	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
low complexity region	1284	1289	N/A	INTRINSIC
low complexity region	1441	1453	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	2183	2193	N/A	INTRINSIC
low complexity region	2964	2977	N/A	INTRINSIC
low complexity region	3371	3381	N/A	INTRINSIC
low complexity region	3687	3699	N/A	INTRINSIC
low complexity region	3839	3853	N/A	INTRINSIC
coiled coil region	4185	4226	N/A	INTRINSIC
low complexity region	4230	4239	N/A	INTRINSIC
low complexity region	4245	4262	N/A	INTRINSIC
low complexity region	4322	4343	N/A	INTRINSIC

Meta Mutation Damage Score

0.1405

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.4%

Validation Efficiency

98% (104/106)

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	A	3: 122,069,012	S206R	probably damaging	Het
Abcc6	G	T	7: 46,014,169	A357E	probably benign	Het
Abhd13	T	A	8: 9,988,170	C256S	probably benign	Het
Actrt3	A	G	3: 30,598,567	V126A	probably damaging	Het
Adgrv1	A	G	13: 81,592,551		probably benign	Het
Alyref2	A	G	1: 171,504,270	D205G	probably damaging	Het
Amigo3	G	A	9: 108,053,636	R86Q	probably benign	Het
Ankrd50	G	C	3: 38,454,052	P1389A	probably damaging	Het
Aoah	A	G	13: 20,910,094	D183G	probably damaging	Het
Arap3	A	T	18: 37,996,671	S146T	probably benign	Het
Atp2c2	T	C	8: 119,749,876		probably benign	Het
Atp8b2	C	T	3: 89,946,276	V682M	probably benign	Het
Cacna1i	T	C	15: 80,375,264	I1245T	probably damaging	Het
Card14	A	G	11: 119,331,259	N460S	probably benign	Het
Ceacam5	A	G	7: 17,752,384	D602G	possibly damaging	Het
Cecr2	T	A	6: 120,761,160	H921Q	probably benign	Het
Cyb5d1	T	C	11: 69,394,740	D115G	probably benign	Het
Dbp	C	T	7: 45,708,320	T67I	possibly damaging	Het
Dennd5b	C	T	6: 149,041,576	V601I	probably benign	Het
Dnah11	G	A	12: 118,127,556	A947V	possibly damaging	Het
Dpysl3	T	A	18: 43,438,128	D27V	probably damaging	Het
Drd1	A	T	13: 54,053,252	D307E	possibly damaging	Het
Dscaml1	G	A	9: 45,740,480	G277D	probably damaging	Het
Eif4g3	C	T	4: 138,158,415	R842W	probably damaging	Het
Enam	C	T	5: 88,504,622	T1330I	possibly damaging	Het
Fabp6	T	C	11: 43,596,167		probably null	Het
Fam160a1	T	C	3: 85,672,633	D755G	probably benign	Het
Fsip2	C	T	2: 82,983,428	P3364S	possibly damaging	Het
Fuk	A	T	8: 110,893,378	L289*	probably null	Het
Gad1	C	T	2: 70,579,138	S191F	possibly damaging	Het
Gcm1	A	C	9: 78,064,773	N332T	probably benign	Het
Gin1	G	A	1: 97,775,447		probably benign	Het
Gpr25	T	C	1: 136,260,800	D25G	probably benign	Het
Gstm4	T	C	3: 108,041,277	T172A	probably benign	Het
Hnrnpll	A	G	17: 80,035,329		probably null	Het
Il12rb2	T	A	6: 67,295,286	K339*	probably null	Het
Inpp1	A	G	1: 52,789,670	*397Q	probably null	Het
Kcp	G	T	6: 29,497,835		probably benign	Het
Kdm1b	G	A	13: 47,064,120	V352I	probably benign	Het
Klhdc2	G	T	12: 69,296,960		probably benign	Het
Krt75	T	A	15: 101,573,366	T156S	possibly damaging	Het
Lag3	T	A	6: 124,909,487	I168F	possibly damaging	Het
Lama4	T	G	10: 39,072,758	V839G	probably benign	Het
Lmtk2	G	T	5: 144,175,110	V883L	probably benign	Het
Lrrc37a	C	A	11: 103,457,156	K2904N	unknown	Het
Macf1	A	T	4: 123,372,399	I4775N	probably damaging	Het
Map2k3	T	G	11: 60,932,229	S3A	possibly damaging	Het
Mast1	G	A	8: 84,916,266	R967C	probably damaging	Het
Mettl2	T	G	11: 105,126,840	S59A	probably benign	Het
Mtr	G	A	13: 12,225,532	T530I	probably damaging	Het
Myo7b	A	T	18: 31,976,999	C1137S	possibly damaging	Het
Nacad	T	A	11: 6,602,540	H217L	probably benign	Het
Ncstn	A	T	1: 172,072,143	V324E	probably damaging	Het
Ndufaf7	C	A	17: 78,942,117	H148N	possibly damaging	Het
Olfr1048	T	C	2: 86,236,110	K242E	possibly damaging	Het
Olfr517	T	A	7: 108,868,498	I219F	possibly damaging	Het
Olfr628	T	A	7: 103,731,983	I19N	probably damaging	Het
Olfr667	G	A	7: 104,917,065	T77I	probably damaging	Het
Olfr834	T	C	9: 18,988,441	I151T	possibly damaging	Het
Olfr874	T	G	9: 37,746,433	L100V	probably benign	Het
Pcdh20	T	C	14: 88,468,704	I387V	probably benign	Het
Pclo	A	G	5: 14,678,511		probably benign	Het
Pcp2	G	A	8: 3,624,904		probably benign	Het
Pde1a	T	A	2: 79,868,307	D393V	probably damaging	Het
Pias4	T	C	10: 81,154,363	D421G	possibly damaging	Het
Pign	T	C	1: 105,638,215	T362A	possibly damaging	Het
Pik3c2g	A	C	6: 139,844,042	K304Q	probably damaging	Het
Pkd2	T	A	5: 104,486,806	W568R	probably damaging	Het
Pld2	T	A	11: 70,544,184	I306N	probably damaging	Het
Plppr3	T	C	10: 79,874,069	K9R	probably damaging	Het
Pramef6	T	A	4: 143,895,491	R431S	possibly damaging	Het
Psme4	T	C	11: 30,810,922	V397A	probably damaging	Het
Ptbp2	A	T	3: 119,761,749	S23R	probably damaging	Het
Ptpn13	A	G	5: 103,580,709	D2074G	probably null	Het
Rab34	T	A	11: 78,191,255	L166H	probably damaging	Het
Rabgap1l	T	A	1: 160,645,310	R519S	probably benign	Het
Rasa1	A	T	13: 85,226,572	L218*	probably null	Het
Reln	A	G	5: 22,044,962		probably null	Het
Rer1	T	C	4: 155,078,499	D94G	possibly damaging	Het
Rhpn1	T	C	15: 75,711,824	V386A	probably benign	Het
Samd3	T	A	10: 26,271,856	C476*	probably null	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sipa1l3	A	G	7: 29,339,167	S352P	possibly damaging	Het
Slc27a2	A	G	2: 126,586,342	Y549C	probably benign	Het
Slc7a9	A	G	7: 35,449,854	T7A	probably benign	Het
Slco4c1	C	T	1: 96,842,499	G280D	probably damaging	Het
Snx19	T	A	9: 30,433,576	V657E	probably damaging	Het
Spata31d1c	A	G	13: 65,035,876	M411V	probably benign	Het
Spice1	T	A	16: 44,357,830	L72*	probably null	Het
Syt14	A	G	1: 192,901,835	L707P	probably damaging	Het
Tab1	T	C	15: 80,153,668	I234T	probably damaging	Het
Tas2r107	T	C	6: 131,659,988	M33V	probably benign	Het
Tbx4	T	A	11: 85,914,523	S479R	possibly damaging	Het
Tssk5	C	T	15: 76,372,893	R263Q	probably benign	Het
Ttn	T	C	2: 76,870,856		probably benign	Het
Ugt2b5	T	A	5: 87,139,630	Q226L	probably benign	Het
Ush2a	C	T	1: 188,715,064	S2483L	probably benign	Het
Wdr95	A	G	5: 149,552,426	Y63C	probably damaging	Het
Xirp2	A	G	2: 67,516,356	I2980M	probably damaging	Het
Yeats4	G	A	10: 117,215,731	T207I	probably benign	Het
Ythdc1	A	G	5: 86,830,630	R561G	probably damaging	Het
Zbtb14	G	A	17: 69,387,390	E28K	possibly damaging	Het
Zfp931	A	T	2: 178,069,891	L21Q	probably damaging	Het
Zyg11b	A	C	4: 108,255,226	M415R	probably damaging	Het

Other mutations in Stard9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Stard9	APN	2	120701847	missense	possibly damaging	0.52
IGL01122:Stard9	APN	2	120698479	missense	possibly damaging	0.93
IGL01318:Stard9	APN	2	120698719	missense	possibly damaging	0.56
IGL01371:Stard9	APN	2	120701368	missense	probably benign	0.04
IGL01394:Stard9	APN	2	120706327	missense	possibly damaging	0.78
IGL01531:Stard9	APN	2	120673604	missense	possibly damaging	0.93
IGL01721:Stard9	APN	2	120703330	missense	probably damaging	1.00
IGL01810:Stard9	APN	2	120699084	missense	possibly damaging	0.95
IGL01829:Stard9	APN	2	120706446	missense	possibly damaging	0.59
IGL01916:Stard9	APN	2	120668016	missense	probably damaging	1.00
IGL02031:Stard9	APN	2	120702339	missense	probably benign	0.27
IGL02081:Stard9	APN	2	120664910	missense	probably damaging	0.98
IGL02558:Stard9	APN	2	120696907	missense	possibly damaging	0.95
IGL02646:Stard9	APN	2	120698992	missense	probably damaging	1.00
IGL02873:Stard9	APN	2	120713807	missense	probably damaging	1.00
IGL03195:Stard9	APN	2	120705802	missense	probably damaging	1.00
IGL03204:Stard9	APN	2	120705802	missense	probably damaging	1.00
FR4737:Stard9	UTSW	2	120696085	small insertion	probably benign
IGL03014:Stard9	UTSW	2	120702194	unclassified	probably benign
PIT4151001:Stard9	UTSW	2	120702756	nonsense	probably null
PIT4498001:Stard9	UTSW	2	120697435	missense	possibly damaging	0.86
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0038:Stard9	UTSW	2	120695832	missense	probably benign
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0116:Stard9	UTSW	2	120634255	missense	probably damaging	0.99
R0398:Stard9	UTSW	2	120696307	missense	probably benign	0.03
R0479:Stard9	UTSW	2	120697596	missense	probably damaging	1.00
R0556:Stard9	UTSW	2	120698923	missense	probably benign	0.09
R0589:Stard9	UTSW	2	120698547	missense	probably benign	0.00
R0609:Stard9	UTSW	2	120706306	missense	probably damaging	1.00
R0611:Stard9	UTSW	2	120699257	missense	probably benign	0.00
R0683:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0751:Stard9	UTSW	2	120697485	missense	probably benign	0.04
R0833:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0836:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0838:Stard9	UTSW	2	120700842	missense	probably damaging	1.00
R0848:Stard9	UTSW	2	120695823	missense	probably damaging	1.00
R0849:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0961:Stard9	UTSW	2	120693439	missense	probably benign	0.01
R0993:Stard9	UTSW	2	120705169	missense	probably damaging	1.00
R1005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1006:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1115:Stard9	UTSW	2	120692850	missense	probably benign	0.05
R1163:Stard9	UTSW	2	120696213	missense	possibly damaging	0.86
R1199:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1200:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1331:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1332:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1333:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1334:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1335:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1336:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1338:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1346:Stard9	UTSW	2	120713448	missense	probably damaging	1.00
R1370:Stard9	UTSW	2	120697477	missense	probably benign	0.11
R1384:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1401:Stard9	UTSW	2	120712847	splice site	probably benign
R1416:Stard9	UTSW	2	120700972	missense	probably benign	0.00
R1453:Stard9	UTSW	2	120666376	missense	probably damaging	1.00
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1525:Stard9	UTSW	2	120702052	missense	probably benign	0.09
R1538:Stard9	UTSW	2	120696711	missense	probably benign	0.25
R1614:Stard9	UTSW	2	120697675	missense	possibly damaging	0.95
R1654:Stard9	UTSW	2	120703722	missense	probably benign	0.37
R1658:Stard9	UTSW	2	120701542	missense	probably benign	0.02
R1686:Stard9	UTSW	2	120699492	missense	probably benign	0.00
R1797:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1803:Stard9	UTSW	2	120701489	missense	probably benign	0.24
R1806:Stard9	UTSW	2	120679453	splice site	probably null
R1847:Stard9	UTSW	2	120698489	missense	possibly damaging	0.51
R1853:Stard9	UTSW	2	120688751	missense	probably damaging	1.00
R1892:Stard9	UTSW	2	120693708	missense	probably benign	0.01
R1906:Stard9	UTSW	2	120696427	missense	probably benign	0.00
R1930:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1933:Stard9	UTSW	2	120698656	missense	possibly damaging	0.55
R1989:Stard9	UTSW	2	120701406	missense	probably benign
R1999:Stard9	UTSW	2	120692868	missense	probably damaging	0.99
R2004:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2005:Stard9	UTSW	2	120664945	missense	possibly damaging	0.90
R2005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2021:Stard9	UTSW	2	120704235	missense	probably benign	0.05
R2025:Stard9	UTSW	2	120702398	missense	probably benign	0.20
R2190:Stard9	UTSW	2	120714120	missense	probably benign	0.22
R2204:Stard9	UTSW	2	120698531	frame shift	probably null
R2422:Stard9	UTSW	2	120700284	missense	probably benign	0.29
R3401:Stard9	UTSW	2	120703689	missense	probably damaging	0.98
R3618:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3619:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3900:Stard9	UTSW	2	120713549	missense	possibly damaging	0.93
R3943:Stard9	UTSW	2	120698229	missense	probably benign	0.11
R4022:Stard9	UTSW	2	120704155	missense	probably benign	0.05
R4223:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4224:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4225:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4345:Stard9	UTSW	2	120701946	missense	probably benign	0.43
R4382:Stard9	UTSW	2	120634222	missense	probably damaging	1.00
R4453:Stard9	UTSW	2	120697791	missense	probably benign
R4499:Stard9	UTSW	2	120700241	missense	probably benign	0.05
R4524:Stard9	UTSW	2	120696445	missense	probably damaging	1.00
R4671:Stard9	UTSW	2	120698640	missense	probably damaging	0.98
R4701:Stard9	UTSW	2	120705713	missense	possibly damaging	0.85
R4744:Stard9	UTSW	2	120696123	missense	probably benign	0.01
R4822:Stard9	UTSW	2	120695941	missense	possibly damaging	0.94
R4847:Stard9	UTSW	2	120703113	missense	probably benign	0.18
R4863:Stard9	UTSW	2	120700860	missense	probably benign	0.00
R4898:Stard9	UTSW	2	120706419	nonsense	probably null
R5033:Stard9	UTSW	2	120693399	missense	probably benign	0.00
R5087:Stard9	UTSW	2	120697019	nonsense	probably null
R5157:Stard9	UTSW	2	120697861	missense	probably benign
R5213:Stard9	UTSW	2	120699226	missense	probably damaging	1.00
R5237:Stard9	UTSW	2	120699358	missense	probably damaging	0.96
R5257:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5258:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5273:Stard9	UTSW	2	120705087	missense	possibly damaging	0.94
R5286:Stard9	UTSW	2	120701947	missense	probably benign	0.43
R5288:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5292:Stard9	UTSW	2	120699145	missense	probably benign	0.17
R5328:Stard9	UTSW	2	120699230	missense	probably damaging	1.00
R5385:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5386:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5393:Stard9	UTSW	2	120702906	missense	possibly damaging	0.87
R5405:Stard9	UTSW	2	120693668	missense	probably benign	0.17
R5685:Stard9	UTSW	2	120705322	missense	probably damaging	1.00
R5749:Stard9	UTSW	2	120703786	missense	probably damaging	1.00
R5780:Stard9	UTSW	2	120703396	missense	probably benign	0.02
R5901:Stard9	UTSW	2	120701370	missense	probably damaging	1.00
R5941:Stard9	UTSW	2	120713558	missense	probably damaging	1.00
R5960:Stard9	UTSW	2	120699961	missense	probably benign	0.05
R5966:Stard9	UTSW	2	120697099	missense	probably damaging	1.00
R5967:Stard9	UTSW	2	120706894	missense	probably damaging	0.99
R6012:Stard9	UTSW	2	120704586	missense	probably damaging	1.00
R6019:Stard9	UTSW	2	120693715	frame shift	probably null
R6020:Stard9	UTSW	2	120693715	frame shift	probably null
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6090:Stard9	UTSW	2	120693654	missense	probably damaging	0.99
R6192:Stard9	UTSW	2	120696760	missense	probably damaging	0.99
R6228:Stard9	UTSW	2	120713750	missense	probably damaging	1.00
R6235:Stard9	UTSW	2	120713546	missense	probably damaging	1.00
R6280:Stard9	UTSW	2	120701127	missense	probably benign
R6338:Stard9	UTSW	2	120697485	missense	probably benign
R6344:Stard9	UTSW	2	120704320	missense	probably benign	0.12
R6364:Stard9	UTSW	2	120713429	missense	probably damaging	1.00
R6383:Stard9	UTSW	2	120666407	critical splice donor site	probably null
R6644:Stard9	UTSW	2	120695772	missense	probably benign	0.11
R6747:Stard9	UTSW	2	120698383	missense	possibly damaging	0.62
R6833:Stard9	UTSW	2	120701259	missense	probably damaging	1.00
R6836:Stard9	UTSW	2	120699843	missense	probably benign	0.15
R6861:Stard9	UTSW	2	120705186	missense	probably benign	0.09
R6872:Stard9	UTSW	2	120714068	nonsense	probably null
R6875:Stard9	UTSW	2	120697436	missense	probably benign	0.04
R6915:Stard9	UTSW	2	120702630	missense	probably benign	0.00
R6934:Stard9	UTSW	2	120697695	missense	probably benign	0.00
R6943:Stard9	UTSW	2	120702196	missense	probably benign	0.29
R7009:Stard9	UTSW	2	120697191	missense	probably benign	0.37
R7031:Stard9	UTSW	2	120700450	missense	possibly damaging	0.61
R7132:Stard9	UTSW	2	120679378	nonsense	probably null
R7151:Stard9	UTSW	2	120696142	missense	probably benign
R7154:Stard9	UTSW	2	120701314	missense	probably benign	0.00
R7154:Stard9	UTSW	2	120704542	missense	probably benign	0.02
R7165:Stard9	UTSW	2	120704158	missense	probably damaging	1.00
R7260:Stard9	UTSW	2	120706938	missense	possibly damaging	0.90
R7270:Stard9	UTSW	2	120634274	nonsense	probably null
R7282:Stard9	UTSW	2	120698503	missense	probably benign	0.00
R7344:Stard9	UTSW	2	120704686	missense	possibly damaging	0.90
R7347:Stard9	UTSW	2	120666534	missense	probably benign
R7359:Stard9	UTSW	2	120698280	missense	probably damaging	1.00
R7410:Stard9	UTSW	2	120701497	missense	probably benign	0.41
R7422:Stard9	UTSW	2	120702152	missense	probably benign	0.21
R7475:Stard9	UTSW	2	120688110	missense	probably damaging	1.00
R7523:Stard9	UTSW	2	120699597	missense	probably benign
R7553:Stard9	UTSW	2	120693808	splice site	probably null
R7624:Stard9	UTSW	2	120688146	missense	probably benign	0.15
X0023:Stard9	UTSW	2	120702744	missense	probably benign	0.00
X0023:Stard9	UTSW	2	120702963	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TTGGGAACTCTAGACTTCTCAGC -3'
(R):5'- TACACAGACTGAGCTGCCATG -3'

Sequencing Primer
(F):5'- CAAGACCACTAGGGATCCAGTTATG -3'
(R):5'- TGCCATGATTGATAGGCACC -3'

Posted On

2014-07-14