Incidental Mutation 'R1907:Ptbp2'
ID214439
Institutional Source Beutler Lab
Gene Symbol Ptbp2
Ensembl Gene ENSMUSG00000028134
Gene Namepolypyrimidine tract binding protein 2
SynonymsbrPTB
MMRRC Submission 039926-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1907 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location119718742-119784466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119761749 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 23 (S23R)
Ref Sequence ENSEMBL: ENSMUSP00000142664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029780] [ENSMUST00000197464] [ENSMUST00000197833] [ENSMUST00000198403] [ENSMUST00000200097]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029780
AA Change: S23R

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029780
Gene: ENSMUSG00000028134
AA Change: S23R

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 1.22e-4 SMART
low complexity region 285 295 N/A INTRINSIC
RRM 339 408 1.07e-9 SMART
RRM 456 526 1.99e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196066
Predicted Effect possibly damaging
Transcript: ENSMUST00000197464
AA Change: S23R

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143281
Gene: ENSMUSG00000028134
AA Change: S23R

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
Pfam:RRM_1 183 239 8.6e-6 PFAM
Pfam:RRM_5 197 240 1.1e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197833
AA Change: S23R

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143719
Gene: ENSMUSG00000028134
AA Change: S23R

DomainStartEndE-ValueType
RRM 60 129 1.7e-8 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 5.2e-7 SMART
low complexity region 285 295 N/A INTRINSIC
PDB:2MJU|A 325 349 4e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198399
Predicted Effect probably damaging
Transcript: ENSMUST00000198403
AA Change: S23R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199701
Predicted Effect possibly damaging
Transcript: ENSMUST00000200097
AA Change: S23R

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143510
Gene: ENSMUSG00000028134
AA Change: S23R

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 1.22e-4 SMART
low complexity region 285 295 N/A INTRINSIC
RRM 339 408 1.07e-9 SMART
RRM 456 525 8.08e-10 SMART
Meta Mutation Damage Score 0.1103 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to intronic polypyrimidine clusters in pre-mRNA molecules and is implicated in controlling the assembly of other splicing-regulatory proteins. This protein is very similar to the polypyrimidine tract binding protein (PTB) but most of its isoforms are expressed primarily in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality with premature neurogenesis and abnormal neural stem cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,069,012 S206R probably damaging Het
Abcc6 G T 7: 46,014,169 A357E probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Actrt3 A G 3: 30,598,567 V126A probably damaging Het
Adgrv1 A G 13: 81,592,551 probably benign Het
Alyref2 A G 1: 171,504,270 D205G probably damaging Het
Amigo3 G A 9: 108,053,636 R86Q probably benign Het
Ankrd50 G C 3: 38,454,052 P1389A probably damaging Het
Aoah A G 13: 20,910,094 D183G probably damaging Het
Arap3 A T 18: 37,996,671 S146T probably benign Het
Atp2c2 T C 8: 119,749,876 probably benign Het
Atp8b2 C T 3: 89,946,276 V682M probably benign Het
Cacna1i T C 15: 80,375,264 I1245T probably damaging Het
Card14 A G 11: 119,331,259 N460S probably benign Het
Ceacam5 A G 7: 17,752,384 D602G possibly damaging Het
Cecr2 T A 6: 120,761,160 H921Q probably benign Het
Cyb5d1 T C 11: 69,394,740 D115G probably benign Het
Dbp C T 7: 45,708,320 T67I possibly damaging Het
Dennd5b C T 6: 149,041,576 V601I probably benign Het
Dnah11 G A 12: 118,127,556 A947V possibly damaging Het
Dpysl3 T A 18: 43,438,128 D27V probably damaging Het
Drd1 A T 13: 54,053,252 D307E possibly damaging Het
Dscaml1 G A 9: 45,740,480 G277D probably damaging Het
Eif4g3 C T 4: 138,158,415 R842W probably damaging Het
Enam C T 5: 88,504,622 T1330I possibly damaging Het
Fabp6 T C 11: 43,596,167 probably null Het
Fam160a1 T C 3: 85,672,633 D755G probably benign Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fuk A T 8: 110,893,378 L289* probably null Het
Gad1 C T 2: 70,579,138 S191F possibly damaging Het
Gcm1 A C 9: 78,064,773 N332T probably benign Het
Gin1 G A 1: 97,775,447 probably benign Het
Gpr25 T C 1: 136,260,800 D25G probably benign Het
Gstm4 T C 3: 108,041,277 T172A probably benign Het
Hnrnpll A G 17: 80,035,329 probably null Het
Il12rb2 T A 6: 67,295,286 K339* probably null Het
Inpp1 A G 1: 52,789,670 *397Q probably null Het
Kcp G T 6: 29,497,835 probably benign Het
Kdm1b G A 13: 47,064,120 V352I probably benign Het
Klhdc2 G T 12: 69,296,960 probably benign Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lag3 T A 6: 124,909,487 I168F possibly damaging Het
Lama4 T G 10: 39,072,758 V839G probably benign Het
Lmtk2 G T 5: 144,175,110 V883L probably benign Het
Lrrc37a C A 11: 103,457,156 K2904N unknown Het
Macf1 A T 4: 123,372,399 I4775N probably damaging Het
Map2k3 T G 11: 60,932,229 S3A possibly damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mettl2 T G 11: 105,126,840 S59A probably benign Het
Mtr G A 13: 12,225,532 T530I probably damaging Het
Myo7b A T 18: 31,976,999 C1137S possibly damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncstn A T 1: 172,072,143 V324E probably damaging Het
Ndufaf7 C A 17: 78,942,117 H148N possibly damaging Het
Olfr1048 T C 2: 86,236,110 K242E possibly damaging Het
Olfr517 T A 7: 108,868,498 I219F possibly damaging Het
Olfr628 T A 7: 103,731,983 I19N probably damaging Het
Olfr667 G A 7: 104,917,065 T77I probably damaging Het
Olfr834 T C 9: 18,988,441 I151T possibly damaging Het
Olfr874 T G 9: 37,746,433 L100V probably benign Het
Pcdh20 T C 14: 88,468,704 I387V probably benign Het
Pclo A G 5: 14,678,511 probably benign Het
Pcp2 G A 8: 3,624,904 probably benign Het
Pde1a T A 2: 79,868,307 D393V probably damaging Het
Pias4 T C 10: 81,154,363 D421G possibly damaging Het
Pign T C 1: 105,638,215 T362A possibly damaging Het
Pik3c2g A C 6: 139,844,042 K304Q probably damaging Het
Pkd2 T A 5: 104,486,806 W568R probably damaging Het
Pld2 T A 11: 70,544,184 I306N probably damaging Het
Plppr3 T C 10: 79,874,069 K9R probably damaging Het
Pramef6 T A 4: 143,895,491 R431S possibly damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptpn13 A G 5: 103,580,709 D2074G probably null Het
Rab34 T A 11: 78,191,255 L166H probably damaging Het
Rabgap1l T A 1: 160,645,310 R519S probably benign Het
Rasa1 A T 13: 85,226,572 L218* probably null Het
Reln A G 5: 22,044,962 probably null Het
Rer1 T C 4: 155,078,499 D94G possibly damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Samd3 T A 10: 26,271,856 C476* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc27a2 A G 2: 126,586,342 Y549C probably benign Het
Slc7a9 A G 7: 35,449,854 T7A probably benign Het
Slco4c1 C T 1: 96,842,499 G280D probably damaging Het
Snx19 T A 9: 30,433,576 V657E probably damaging Het
Spata31d1c A G 13: 65,035,876 M411V probably benign Het
Spice1 T A 16: 44,357,830 L72* probably null Het
Stard9 G T 2: 120,713,812 V4471L probably damaging Het
Syt14 A G 1: 192,901,835 L707P probably damaging Het
Tab1 T C 15: 80,153,668 I234T probably damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tbx4 T A 11: 85,914,523 S479R possibly damaging Het
Tssk5 C T 15: 76,372,893 R263Q probably benign Het
Ttn T C 2: 76,870,856 probably benign Het
Ugt2b5 T A 5: 87,139,630 Q226L probably benign Het
Ush2a C T 1: 188,715,064 S2483L probably benign Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Yeats4 G A 10: 117,215,731 T207I probably benign Het
Ythdc1 A G 5: 86,830,630 R561G probably damaging Het
Zbtb14 G A 17: 69,387,390 E28K possibly damaging Het
Zfp931 A T 2: 178,069,891 L21Q probably damaging Het
Zyg11b A C 4: 108,255,226 M415R probably damaging Het
Other mutations in Ptbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Ptbp2 APN 3 119747812 missense probably damaging 1.00
IGL01874:Ptbp2 APN 3 119747800 missense probably damaging 1.00
IGL01940:Ptbp2 APN 3 119726115 missense possibly damaging 0.46
IGL02094:Ptbp2 APN 3 119752940 splice site probably benign
IGL02374:Ptbp2 APN 3 119720693 splice site probably benign
IGL02523:Ptbp2 APN 3 119740487 nonsense probably null
IGL02879:Ptbp2 APN 3 119740405 missense probably damaging 1.00
IGL03149:Ptbp2 APN 3 119720425 missense possibly damaging 0.86
IGL03153:Ptbp2 APN 3 119751944 missense probably benign 0.04
IGL03391:Ptbp2 APN 3 119720382 nonsense probably null
R0067:Ptbp2 UTSW 3 119720641 missense probably benign 0.00
R0067:Ptbp2 UTSW 3 119720641 missense probably benign 0.00
R0091:Ptbp2 UTSW 3 119720661 missense probably damaging 1.00
R0396:Ptbp2 UTSW 3 119724198 splice site probably benign
R0511:Ptbp2 UTSW 3 119720964 missense probably benign
R0722:Ptbp2 UTSW 3 119720921 missense possibly damaging 0.72
R1573:Ptbp2 UTSW 3 119753105 missense probably damaging 1.00
R3606:Ptbp2 UTSW 3 119747632 missense probably damaging 1.00
R5082:Ptbp2 UTSW 3 119752964 missense probably benign 0.06
R5575:Ptbp2 UTSW 3 119720783 splice site probably null
R5575:Ptbp2 UTSW 3 119720789 missense possibly damaging 0.86
R5655:Ptbp2 UTSW 3 119724157 missense probably benign 0.44
R5836:Ptbp2 UTSW 3 119726097 missense probably damaging 0.98
R6290:Ptbp2 UTSW 3 119724120 missense possibly damaging 0.50
R6364:Ptbp2 UTSW 3 119740442 missense probably damaging 1.00
R6398:Ptbp2 UTSW 3 119720835 missense probably benign 0.23
R6574:Ptbp2 UTSW 3 119747947 missense probably damaging 0.99
R7037:Ptbp2 UTSW 3 119751908 missense probably damaging 1.00
R7243:Ptbp2 UTSW 3 119753112 missense possibly damaging 0.47
R7718:Ptbp2 UTSW 3 119720988 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATTGAAACACTACTTGCCC -3'
(R):5'- ACACGTGTACTTGGTGTAGATG -3'

Sequencing Primer
(F):5'- TTGCCCACAAAAATTACCAAATTCAG -3'
(R):5'- CTTTAGGGCAGGGATTCTCAACC -3'
Posted On2014-07-14