Incidental Mutation 'R1907:Ptpn13'
ID214452
Institutional Source Beutler Lab
Gene Symbol Ptpn13
Ensembl Gene ENSMUSG00000034573
Gene Nameprotein tyrosine phosphatase, non-receptor type 13
SynonymsPTPL1, Ptpri, PTP-BL
MMRRC Submission 039926-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R1907 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location103425192-103598303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103580709 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2074 (D2074G)
Ref Sequence ENSEMBL: ENSMUSP00000048119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048957]
Predicted Effect probably null
Transcript: ENSMUST00000048957
AA Change: D2074G

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573
AA Change: D2074G

DomainStartEndE-ValueType
KIND 3 190 2.3e-80 SMART
Blast:B41 340 447 6e-34 BLAST
coiled coil region 460 487 N/A INTRINSIC
B41 561 774 3.3e-68 SMART
FERM_C 780 869 3.2e-35 SMART
low complexity region 1049 1058 N/A INTRINSIC
PDZ 1093 1170 7.6e-25 SMART
low complexity region 1224 1236 N/A INTRINSIC
low complexity region 1309 1322 N/A INTRINSIC
low complexity region 1331 1341 N/A INTRINSIC
PDZ 1365 1442 1.7e-24 SMART
low complexity region 1450 1468 N/A INTRINSIC
PDZ 1499 1579 3.5e-19 SMART
PDZ 1773 1845 1.2e-21 SMART
PDZ 1867 1942 1.6e-16 SMART
low complexity region 2123 2134 N/A INTRINSIC
PTPc 2179 2436 6.9e-113 SMART
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,069,012 S206R probably damaging Het
Abcc6 G T 7: 46,014,169 A357E probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Actrt3 A G 3: 30,598,567 V126A probably damaging Het
Adgrv1 A G 13: 81,592,551 probably benign Het
Alyref2 A G 1: 171,504,270 D205G probably damaging Het
Amigo3 G A 9: 108,053,636 R86Q probably benign Het
Ankrd50 G C 3: 38,454,052 P1389A probably damaging Het
Aoah A G 13: 20,910,094 D183G probably damaging Het
Arap3 A T 18: 37,996,671 S146T probably benign Het
Atp2c2 T C 8: 119,749,876 probably benign Het
Atp8b2 C T 3: 89,946,276 V682M probably benign Het
Cacna1i T C 15: 80,375,264 I1245T probably damaging Het
Card14 A G 11: 119,331,259 N460S probably benign Het
Ceacam5 A G 7: 17,752,384 D602G possibly damaging Het
Cecr2 T A 6: 120,761,160 H921Q probably benign Het
Cyb5d1 T C 11: 69,394,740 D115G probably benign Het
Dbp C T 7: 45,708,320 T67I possibly damaging Het
Dennd5b C T 6: 149,041,576 V601I probably benign Het
Dnah11 G A 12: 118,127,556 A947V possibly damaging Het
Dpysl3 T A 18: 43,438,128 D27V probably damaging Het
Drd1 A T 13: 54,053,252 D307E possibly damaging Het
Dscaml1 G A 9: 45,740,480 G277D probably damaging Het
Eif4g3 C T 4: 138,158,415 R842W probably damaging Het
Enam C T 5: 88,504,622 T1330I possibly damaging Het
Fabp6 T C 11: 43,596,167 probably null Het
Fam160a1 T C 3: 85,672,633 D755G probably benign Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fuk A T 8: 110,893,378 L289* probably null Het
Gad1 C T 2: 70,579,138 S191F possibly damaging Het
Gcm1 A C 9: 78,064,773 N332T probably benign Het
Gin1 G A 1: 97,775,447 probably benign Het
Gpr25 T C 1: 136,260,800 D25G probably benign Het
Gstm4 T C 3: 108,041,277 T172A probably benign Het
Hnrnpll A G 17: 80,035,329 probably null Het
Il12rb2 T A 6: 67,295,286 K339* probably null Het
Inpp1 A G 1: 52,789,670 *397Q probably null Het
Kcp G T 6: 29,497,835 probably benign Het
Kdm1b G A 13: 47,064,120 V352I probably benign Het
Klhdc2 G T 12: 69,296,960 probably benign Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lag3 T A 6: 124,909,487 I168F possibly damaging Het
Lama4 T G 10: 39,072,758 V839G probably benign Het
Lmtk2 G T 5: 144,175,110 V883L probably benign Het
Lrrc37a C A 11: 103,457,156 K2904N unknown Het
Macf1 A T 4: 123,372,399 I4775N probably damaging Het
Map2k3 T G 11: 60,932,229 S3A possibly damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mettl2 T G 11: 105,126,840 S59A probably benign Het
Mtr G A 13: 12,225,532 T530I probably damaging Het
Myo7b A T 18: 31,976,999 C1137S possibly damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncstn A T 1: 172,072,143 V324E probably damaging Het
Ndufaf7 C A 17: 78,942,117 H148N possibly damaging Het
Olfr1048 T C 2: 86,236,110 K242E possibly damaging Het
Olfr517 T A 7: 108,868,498 I219F possibly damaging Het
Olfr628 T A 7: 103,731,983 I19N probably damaging Het
Olfr667 G A 7: 104,917,065 T77I probably damaging Het
Olfr834 T C 9: 18,988,441 I151T possibly damaging Het
Olfr874 T G 9: 37,746,433 L100V probably benign Het
Pcdh20 T C 14: 88,468,704 I387V probably benign Het
Pclo A G 5: 14,678,511 probably benign Het
Pcp2 G A 8: 3,624,904 probably benign Het
Pde1a T A 2: 79,868,307 D393V probably damaging Het
Pias4 T C 10: 81,154,363 D421G possibly damaging Het
Pign T C 1: 105,638,215 T362A possibly damaging Het
Pik3c2g A C 6: 139,844,042 K304Q probably damaging Het
Pkd2 T A 5: 104,486,806 W568R probably damaging Het
Pld2 T A 11: 70,544,184 I306N probably damaging Het
Plppr3 T C 10: 79,874,069 K9R probably damaging Het
Pramef6 T A 4: 143,895,491 R431S possibly damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptbp2 A T 3: 119,761,749 S23R probably damaging Het
Rab34 T A 11: 78,191,255 L166H probably damaging Het
Rabgap1l T A 1: 160,645,310 R519S probably benign Het
Rasa1 A T 13: 85,226,572 L218* probably null Het
Reln A G 5: 22,044,962 probably null Het
Rer1 T C 4: 155,078,499 D94G possibly damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Samd3 T A 10: 26,271,856 C476* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc27a2 A G 2: 126,586,342 Y549C probably benign Het
Slc7a9 A G 7: 35,449,854 T7A probably benign Het
Slco4c1 C T 1: 96,842,499 G280D probably damaging Het
Snx19 T A 9: 30,433,576 V657E probably damaging Het
Spata31d1c A G 13: 65,035,876 M411V probably benign Het
Spice1 T A 16: 44,357,830 L72* probably null Het
Stard9 G T 2: 120,713,812 V4471L probably damaging Het
Syt14 A G 1: 192,901,835 L707P probably damaging Het
Tab1 T C 15: 80,153,668 I234T probably damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tbx4 T A 11: 85,914,523 S479R possibly damaging Het
Tssk5 C T 15: 76,372,893 R263Q probably benign Het
Ttn T C 2: 76,870,856 probably benign Het
Ugt2b5 T A 5: 87,139,630 Q226L probably benign Het
Ush2a C T 1: 188,715,064 S2483L probably benign Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Yeats4 G A 10: 117,215,731 T207I probably benign Het
Ythdc1 A G 5: 86,830,630 R561G probably damaging Het
Zbtb14 G A 17: 69,387,390 E28K possibly damaging Het
Zfp931 A T 2: 178,069,891 L21Q probably damaging Het
Zyg11b A C 4: 108,255,226 M415R probably damaging Het
Other mutations in Ptpn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptpn13 APN 5 103551058 missense probably damaging 1.00
IGL00569:Ptpn13 APN 5 103591006 splice site probably benign
IGL00764:Ptpn13 APN 5 103597718 missense probably damaging 1.00
IGL00805:Ptpn13 APN 5 103554729 missense probably benign 0.33
IGL00922:Ptpn13 APN 5 103588088 missense probably damaging 1.00
IGL00959:Ptpn13 APN 5 103517571 critical splice donor site probably null
IGL01090:Ptpn13 APN 5 103541314 missense probably null 0.80
IGL01352:Ptpn13 APN 5 103486775 splice site probably null
IGL01510:Ptpn13 APN 5 103562300 missense probably damaging 1.00
IGL01515:Ptpn13 APN 5 103556113 missense probably benign 0.06
IGL01896:Ptpn13 APN 5 103501523 missense possibly damaging 0.78
IGL02094:Ptpn13 APN 5 103594617 missense probably damaging 1.00
IGL02561:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02562:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02567:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02604:Ptpn13 APN 5 103501903 missense probably benign 0.01
IGL02679:Ptpn13 APN 5 103569454 missense possibly damaging 0.55
IGL02981:Ptpn13 APN 5 103528804 missense probably damaging 1.00
IGL03131:Ptpn13 APN 5 103517559 missense probably benign
IGL03136:Ptpn13 APN 5 103543463 missense possibly damaging 0.49
IGL03163:Ptpn13 APN 5 103591346 missense probably damaging 1.00
IGL03271:Ptpn13 APN 5 103462148 missense probably damaging 1.00
IGL03297:Ptpn13 APN 5 103541077 missense probably benign 0.13
IGL03328:Ptpn13 APN 5 103516348 missense probably benign 0.00
IGL03343:Ptpn13 APN 5 103554950 missense possibly damaging 0.88
IGL02835:Ptpn13 UTSW 5 103560025 missense probably damaging 0.98
P0021:Ptpn13 UTSW 5 103528820 missense probably benign 0.39
R0017:Ptpn13 UTSW 5 103486772 critical splice donor site probably null
R0090:Ptpn13 UTSW 5 103569503 missense probably damaging 1.00
R0111:Ptpn13 UTSW 5 103580763 splice site probably benign
R0183:Ptpn13 UTSW 5 103516408 missense probably benign 0.00
R0230:Ptpn13 UTSW 5 103527131 missense probably damaging 1.00
R0302:Ptpn13 UTSW 5 103565225 missense probably benign
R0360:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0364:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0388:Ptpn13 UTSW 5 103555062 missense probably benign 0.31
R0504:Ptpn13 UTSW 5 103501496 missense possibly damaging 0.92
R0558:Ptpn13 UTSW 5 103529717 missense probably damaging 0.99
R0562:Ptpn13 UTSW 5 103516425 critical splice donor site probably null
R0568:Ptpn13 UTSW 5 103489765 missense probably damaging 1.00
R0609:Ptpn13 UTSW 5 103556145 missense probably benign
R0669:Ptpn13 UTSW 5 103556109 missense probably benign
R0739:Ptpn13 UTSW 5 103575132 missense probably benign
R1006:Ptpn13 UTSW 5 103586789 missense probably benign 0.04
R1164:Ptpn13 UTSW 5 103489773 missense probably damaging 1.00
R1274:Ptpn13 UTSW 5 103550260 missense probably damaging 0.98
R1501:Ptpn13 UTSW 5 103516364 missense probably benign 0.01
R1529:Ptpn13 UTSW 5 103564132 missense probably benign 0.00
R1533:Ptpn13 UTSW 5 103556178 nonsense probably null
R1613:Ptpn13 UTSW 5 103536871 missense possibly damaging 0.89
R1616:Ptpn13 UTSW 5 103565237 missense possibly damaging 0.49
R1830:Ptpn13 UTSW 5 103543459 missense probably benign 0.00
R1892:Ptpn13 UTSW 5 103501679 missense possibly damaging 0.92
R2143:Ptpn13 UTSW 5 103556133 missense probably benign
R2145:Ptpn13 UTSW 5 103556133 missense probably benign
R2151:Ptpn13 UTSW 5 103525785 missense probably damaging 1.00
R2180:Ptpn13 UTSW 5 103569558 missense probably damaging 1.00
R2264:Ptpn13 UTSW 5 103489661 missense possibly damaging 0.96
R2313:Ptpn13 UTSW 5 103564161 missense probably damaging 1.00
R3522:Ptpn13 UTSW 5 103589854 splice site probably benign
R3773:Ptpn13 UTSW 5 103477121 missense probably damaging 1.00
R3924:Ptpn13 UTSW 5 103550741 splice site probably benign
R4289:Ptpn13 UTSW 5 103533285 missense probably damaging 1.00
R4348:Ptpn13 UTSW 5 103569726 missense probably damaging 1.00
R4385:Ptpn13 UTSW 5 103533407 splice site probably null
R4526:Ptpn13 UTSW 5 103501469 missense probably benign 0.32
R4557:Ptpn13 UTSW 5 103541110 missense probably damaging 1.00
R4596:Ptpn13 UTSW 5 103523692 missense probably benign 0.06
R4632:Ptpn13 UTSW 5 103569860 missense possibly damaging 0.46
R4727:Ptpn13 UTSW 5 103569855 missense probably benign
R4780:Ptpn13 UTSW 5 103586773 missense probably benign 0.04
R4793:Ptpn13 UTSW 5 103582778 critical splice donor site probably null
R4812:Ptpn13 UTSW 5 103523615 missense probably benign 0.00
R4939:Ptpn13 UTSW 5 103517469 intron probably null
R4951:Ptpn13 UTSW 5 103588046 missense probably benign 0.00
R5052:Ptpn13 UTSW 5 103561980 missense probably damaging 1.00
R5148:Ptpn13 UTSW 5 103492232 missense probably damaging 1.00
R5309:Ptpn13 UTSW 5 103541053 missense probably damaging 1.00
R5521:Ptpn13 UTSW 5 103501428 missense probably benign 0.03
R5545:Ptpn13 UTSW 5 103561964 missense probably damaging 1.00
R5696:Ptpn13 UTSW 5 103554759 missense probably benign 0.20
R5735:Ptpn13 UTSW 5 103554820 missense probably benign 0.03
R5815:Ptpn13 UTSW 5 103597690 splice site probably null
R5876:Ptpn13 UTSW 5 103476960 missense probably damaging 1.00
R5878:Ptpn13 UTSW 5 103477118 missense possibly damaging 0.89
R6366:Ptpn13 UTSW 5 103551053 missense probably damaging 1.00
R6455:Ptpn13 UTSW 5 103541284 missense probably benign 0.00
R6492:Ptpn13 UTSW 5 103501612 missense probably benign 0.02
R6709:Ptpn13 UTSW 5 103586756 missense probably benign 0.18
R6759:Ptpn13 UTSW 5 103565255 missense possibly damaging 0.49
R6944:Ptpn13 UTSW 5 103476991 missense probably null 1.00
R7079:Ptpn13 UTSW 5 103501886 missense probably benign 0.00
R7253:Ptpn13 UTSW 5 103565284 missense possibly damaging 0.68
R7254:Ptpn13 UTSW 5 103594636 missense probably damaging 1.00
R7391:Ptpn13 UTSW 5 103540981 missense probably damaging 1.00
R7451:Ptpn13 UTSW 5 103527095 missense probably benign 0.16
R7614:Ptpn13 UTSW 5 103501465 missense probably benign 0.13
R7652:Ptpn13 UTSW 5 103529712 missense probably benign 0.12
R7655:Ptpn13 UTSW 5 103540983 missense probably benign 0.00
R7656:Ptpn13 UTSW 5 103540983 missense probably benign 0.00
R7683:Ptpn13 UTSW 5 103565152 missense probably benign 0.01
R7734:Ptpn13 UTSW 5 103561962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTTGGCTTGGTTAAAGGGC -3'
(R):5'- AGGTGTGGATGTCACTGCAATG -3'

Sequencing Primer
(F):5'- CTTGGTTAAAGGGCTCGCAC -3'
(R):5'- TAAAACTACCTTCCTCTACCCCC -3'
Posted On2014-07-14