Incidental Mutation 'R1907:Dennd5b'
ID 214463
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 039926-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R1907 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 148943074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 601 (V601I)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
AlphaFold A2RSQ0
Predicted Effect probably benign
Transcript: ENSMUST00000111557
AA Change: V601I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: V601I

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204583
Meta Mutation Damage Score 0.1546 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 98% (104/106)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 121,862,661 (GRCm39) S206R probably damaging Het
Abcc6 G T 7: 45,663,593 (GRCm39) A357E probably benign Het
Abhd13 T A 8: 10,038,170 (GRCm39) C256S probably benign Het
Actrt3 A G 3: 30,652,716 (GRCm39) V126A probably damaging Het
Adgrv1 A G 13: 81,740,670 (GRCm39) probably benign Het
Alyref2 A G 1: 171,331,838 (GRCm39) D205G probably damaging Het
Amigo3 G A 9: 107,930,835 (GRCm39) R86Q probably benign Het
Ankrd50 G C 3: 38,508,201 (GRCm39) P1389A probably damaging Het
Aoah A G 13: 21,094,264 (GRCm39) D183G probably damaging Het
Arap3 A T 18: 38,129,724 (GRCm39) S146T probably benign Het
Atp2c2 T C 8: 120,476,615 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,853,583 (GRCm39) V682M probably benign Het
Cacna1i T C 15: 80,259,465 (GRCm39) I1245T probably damaging Het
Card14 A G 11: 119,222,085 (GRCm39) N460S probably benign Het
Ceacam5 A G 7: 17,486,309 (GRCm39) D602G possibly damaging Het
Cecr2 T A 6: 120,738,121 (GRCm39) H921Q probably benign Het
Cyb5d1 T C 11: 69,285,566 (GRCm39) D115G probably benign Het
Dbp C T 7: 45,357,744 (GRCm39) T67I possibly damaging Het
Dnah11 G A 12: 118,091,291 (GRCm39) A947V possibly damaging Het
Dpysl3 T A 18: 43,571,193 (GRCm39) D27V probably damaging Het
Drd1 A T 13: 54,207,271 (GRCm39) D307E possibly damaging Het
Dscaml1 G A 9: 45,651,778 (GRCm39) G277D probably damaging Het
Eif4g3 C T 4: 137,885,726 (GRCm39) R842W probably damaging Het
Enam C T 5: 88,652,481 (GRCm39) T1330I possibly damaging Het
Fabp6 T C 11: 43,486,994 (GRCm39) probably null Het
Fcsk A T 8: 111,620,010 (GRCm39) L289* probably null Het
Fhip1a T C 3: 85,579,940 (GRCm39) D755G probably benign Het
Fsip2 C T 2: 82,813,772 (GRCm39) P3364S possibly damaging Het
Gad1 C T 2: 70,409,482 (GRCm39) S191F possibly damaging Het
Gcm1 A C 9: 77,972,055 (GRCm39) N332T probably benign Het
Gin1 G A 1: 97,703,172 (GRCm39) probably benign Het
Gpr25 T C 1: 136,188,538 (GRCm39) D25G probably benign Het
Gstm4 T C 3: 107,948,593 (GRCm39) T172A probably benign Het
Hnrnpll A G 17: 80,342,758 (GRCm39) probably null Het
Il12rb2 T A 6: 67,272,270 (GRCm39) K339* probably null Het
Inpp1 A G 1: 52,828,829 (GRCm39) *397Q probably null Het
Kcp G T 6: 29,497,834 (GRCm39) probably benign Het
Kdm1b G A 13: 47,217,596 (GRCm39) V352I probably benign Het
Klhdc2 G T 12: 69,343,734 (GRCm39) probably benign Het
Krt75 T A 15: 101,481,801 (GRCm39) T156S possibly damaging Het
Lag3 T A 6: 124,886,450 (GRCm39) I168F possibly damaging Het
Lama4 T G 10: 38,948,754 (GRCm39) V839G probably benign Het
Lmtk2 G T 5: 144,111,928 (GRCm39) V883L probably benign Het
Lrrc37a C A 11: 103,347,982 (GRCm39) K2904N unknown Het
Macf1 A T 4: 123,266,192 (GRCm39) I4775N probably damaging Het
Map2k3 T G 11: 60,823,055 (GRCm39) S3A possibly damaging Het
Mast1 G A 8: 85,642,895 (GRCm39) R967C probably damaging Het
Mettl2 T G 11: 105,017,666 (GRCm39) S59A probably benign Het
Mtr G A 13: 12,240,418 (GRCm39) T530I probably damaging Het
Myo7b A T 18: 32,110,052 (GRCm39) C1137S possibly damaging Het
Nacad T A 11: 6,552,540 (GRCm39) H217L probably benign Het
Ncstn A T 1: 171,899,710 (GRCm39) V324E probably damaging Het
Ndufaf7 C A 17: 79,249,546 (GRCm39) H148N possibly damaging Het
Or10a49 T A 7: 108,467,705 (GRCm39) I219F possibly damaging Het
Or52a24 T A 7: 103,381,190 (GRCm39) I19N probably damaging Het
Or52n2b G A 7: 104,566,272 (GRCm39) T77I probably damaging Het
Or7g12 T C 9: 18,899,737 (GRCm39) I151T possibly damaging Het
Or8b12 T G 9: 37,657,729 (GRCm39) L100V probably benign Het
Or8k17 T C 2: 86,066,454 (GRCm39) K242E possibly damaging Het
Pcdh20 T C 14: 88,706,140 (GRCm39) I387V probably benign Het
Pclo A G 5: 14,728,525 (GRCm39) probably benign Het
Pcp2 G A 8: 3,674,904 (GRCm39) probably benign Het
Pde1a T A 2: 79,698,651 (GRCm39) D393V probably damaging Het
Pias4 T C 10: 80,990,197 (GRCm39) D421G possibly damaging Het
Pign T C 1: 105,565,940 (GRCm39) T362A possibly damaging Het
Pik3c2g A C 6: 139,789,768 (GRCm39) K304Q probably damaging Het
Pkd2 T A 5: 104,634,672 (GRCm39) W568R probably damaging Het
Pld2 T A 11: 70,435,010 (GRCm39) I306N probably damaging Het
Plppr3 T C 10: 79,709,903 (GRCm39) K9R probably damaging Het
Pramel11 T A 4: 143,622,061 (GRCm39) R431S possibly damaging Het
Psme4 T C 11: 30,760,922 (GRCm39) V397A probably damaging Het
Ptbp2 A T 3: 119,555,398 (GRCm39) S23R probably damaging Het
Ptpn13 A G 5: 103,728,575 (GRCm39) D2074G probably null Het
Rab34 T A 11: 78,082,081 (GRCm39) L166H probably damaging Het
Rabgap1l T A 1: 160,472,880 (GRCm39) R519S probably benign Het
Rasa1 A T 13: 85,374,691 (GRCm39) L218* probably null Het
Reln A G 5: 22,249,960 (GRCm39) probably null Het
Rer1 T C 4: 155,162,956 (GRCm39) D94G possibly damaging Het
Rhpn1 T C 15: 75,583,673 (GRCm39) V386A probably benign Het
Samd3 T A 10: 26,147,754 (GRCm39) C476* probably null Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sipa1l3 A G 7: 29,038,592 (GRCm39) S352P possibly damaging Het
Slc27a2 A G 2: 126,428,262 (GRCm39) Y549C probably benign Het
Slc7a9 A G 7: 35,149,279 (GRCm39) T7A probably benign Het
Slco4c1 C T 1: 96,770,224 (GRCm39) G280D probably damaging Het
Snx19 T A 9: 30,344,872 (GRCm39) V657E probably damaging Het
Spata31d1c A G 13: 65,183,690 (GRCm39) M411V probably benign Het
Spice1 T A 16: 44,178,193 (GRCm39) L72* probably null Het
Stard9 G T 2: 120,544,293 (GRCm39) V4471L probably damaging Het
Syt14 A G 1: 192,584,143 (GRCm39) L707P probably damaging Het
Tab1 T C 15: 80,037,869 (GRCm39) I234T probably damaging Het
Tas2r107 T C 6: 131,636,951 (GRCm39) M33V probably benign Het
Tbx4 T A 11: 85,805,349 (GRCm39) S479R possibly damaging Het
Tssk5 C T 15: 76,257,093 (GRCm39) R263Q probably benign Het
Ttn T C 2: 76,701,200 (GRCm39) probably benign Het
Ugt2b5 T A 5: 87,287,489 (GRCm39) Q226L probably benign Het
Ush2a C T 1: 188,447,261 (GRCm39) S2483L probably benign Het
Wdr95 A G 5: 149,475,891 (GRCm39) Y63C probably damaging Het
Xirp2 A G 2: 67,346,700 (GRCm39) I2980M probably damaging Het
Yeats4 G A 10: 117,051,636 (GRCm39) T207I probably benign Het
Ythdc1 A G 5: 86,978,489 (GRCm39) R561G probably damaging Het
Zbtb14 G A 17: 69,694,385 (GRCm39) E28K possibly damaging Het
Zfp931 A T 2: 177,711,684 (GRCm39) L21Q probably damaging Het
Zyg11b A C 4: 108,112,423 (GRCm39) M415R probably damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATCTCATGGATTTTAATGTACACC -3'
(R):5'- AGGCTTCTTTTCTCTCTGACCAG -3'

Sequencing Primer
(F):5'- TCAGATCATGAATGGCTAACAATG -3'
(R):5'- TGACCAGCCTGAGCCTTAC -3'
Posted On 2014-07-14