Incidental Mutation 'R1907:Sipa1l3'
ID214465
Institutional Source Beutler Lab
Gene Symbol Sipa1l3
Ensembl Gene ENSMUSG00000030583
Gene Namesignal-induced proliferation-associated 1 like 3
Synonyms2610511M17Rik
MMRRC Submission 039926-MU
Accession Numbers

NCBI RefSeq: NM_001081028.1; MGI: 1921456

Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock #R1907 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29320372-29518641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29339167 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 352 (S352P)
Ref Sequence ENSEMBL: ENSMUSP00000138714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085809] [ENSMUST00000182484] [ENSMUST00000183096]
Predicted Effect probably benign
Transcript: ENSMUST00000085809
AA Change: S1401P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082965
Gene: ENSMUSG00000030583
AA Change: S1401P

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 816 1.7e-68 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:SPAR_C 1471 1721 1.6e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182223
Predicted Effect possibly damaging
Transcript: ENSMUST00000182484
AA Change: S352P

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138714
Gene: ENSMUSG00000030583
AA Change: S352P

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
Pfam:DUF3401 422 671 2.7e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182829
Predicted Effect probably benign
Transcript: ENSMUST00000183096
AA Change: S1401P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138171
Gene: ENSMUSG00000030583
AA Change: S1401P

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 822 6.7e-64 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:DUF3401 1471 1721 7.2e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183164
Predicted Effect unknown
Transcript: ENSMUST00000183330
AA Change: S441P
Meta Mutation Damage Score 0.0892 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the signal induced proliferation associated 1 family of genes, which encode GTPase-activating proteins specific for the GTP-binding protein Rap1. Rap1 has been implicated in regulation of cell adhesion, cell polarity, and organization of the cytoskeleton. Like other members of the family, the protein encoded by this gene contains RapGAP and PDZ domains. In addition, this protein contains a C-terminal leucine zipper domain. This gene is proposed to function in epithelial cell morphogenesis and establishment or maintenance of polarity. Consistently, expression of the protein in cell culture showed localization to cell-cell borders in apical regions, and downregulation of the gene in 3D Caco2 cell culture resulted in abnormal cell polarity and morphogenesis. Allelic variants of this gene have been associated with congenital cataracts in humans. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small lenses, microphthalmia, cataracts, posterior iris synechia, and abnormal lens fiber morphology. [provided by MGI curators]
Allele List at MGI

All alleles(486) : Gene trapped(486)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,069,012 S206R probably damaging Het
Abcc6 G T 7: 46,014,169 A357E probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Actrt3 A G 3: 30,598,567 V126A probably damaging Het
Adgrv1 A G 13: 81,592,551 probably benign Het
Alyref2 A G 1: 171,504,270 D205G probably damaging Het
Amigo3 G A 9: 108,053,636 R86Q probably benign Het
Ankrd50 G C 3: 38,454,052 P1389A probably damaging Het
Aoah A G 13: 20,910,094 D183G probably damaging Het
Arap3 A T 18: 37,996,671 S146T probably benign Het
Atp2c2 T C 8: 119,749,876 probably benign Het
Atp8b2 C T 3: 89,946,276 V682M probably benign Het
Cacna1i T C 15: 80,375,264 I1245T probably damaging Het
Card14 A G 11: 119,331,259 N460S probably benign Het
Ceacam5 A G 7: 17,752,384 D602G possibly damaging Het
Cecr2 T A 6: 120,761,160 H921Q probably benign Het
Cyb5d1 T C 11: 69,394,740 D115G probably benign Het
Dbp C T 7: 45,708,320 T67I possibly damaging Het
Dennd5b C T 6: 149,041,576 V601I probably benign Het
Dnah11 G A 12: 118,127,556 A947V possibly damaging Het
Dpysl3 T A 18: 43,438,128 D27V probably damaging Het
Drd1 A T 13: 54,053,252 D307E possibly damaging Het
Dscaml1 G A 9: 45,740,480 G277D probably damaging Het
Eif4g3 C T 4: 138,158,415 R842W probably damaging Het
Enam C T 5: 88,504,622 T1330I possibly damaging Het
Fabp6 T C 11: 43,596,167 probably null Het
Fam160a1 T C 3: 85,672,633 D755G probably benign Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fuk A T 8: 110,893,378 L289* probably null Het
Gad1 C T 2: 70,579,138 S191F possibly damaging Het
Gcm1 A C 9: 78,064,773 N332T probably benign Het
Gin1 G A 1: 97,775,447 probably benign Het
Gpr25 T C 1: 136,260,800 D25G probably benign Het
Gstm4 T C 3: 108,041,277 T172A probably benign Het
Hnrnpll A G 17: 80,035,329 probably null Het
Il12rb2 T A 6: 67,295,286 K339* probably null Het
Inpp1 A G 1: 52,789,670 *397Q probably null Het
Kcp G T 6: 29,497,835 probably benign Het
Kdm1b G A 13: 47,064,120 V352I probably benign Het
Klhdc2 G T 12: 69,296,960 probably benign Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lag3 T A 6: 124,909,487 I168F possibly damaging Het
Lama4 T G 10: 39,072,758 V839G probably benign Het
Lmtk2 G T 5: 144,175,110 V883L probably benign Het
Lrrc37a C A 11: 103,457,156 K2904N unknown Het
Macf1 A T 4: 123,372,399 I4775N probably damaging Het
Map2k3 T G 11: 60,932,229 S3A possibly damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mettl2 T G 11: 105,126,840 S59A probably benign Het
Mtr G A 13: 12,225,532 T530I probably damaging Het
Myo7b A T 18: 31,976,999 C1137S possibly damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncstn A T 1: 172,072,143 V324E probably damaging Het
Ndufaf7 C A 17: 78,942,117 H148N possibly damaging Het
Olfr1048 T C 2: 86,236,110 K242E possibly damaging Het
Olfr517 T A 7: 108,868,498 I219F possibly damaging Het
Olfr628 T A 7: 103,731,983 I19N probably damaging Het
Olfr667 G A 7: 104,917,065 T77I probably damaging Het
Olfr834 T C 9: 18,988,441 I151T possibly damaging Het
Olfr874 T G 9: 37,746,433 L100V probably benign Het
Pcdh20 T C 14: 88,468,704 I387V probably benign Het
Pclo A G 5: 14,678,511 probably benign Het
Pcp2 G A 8: 3,624,904 probably benign Het
Pde1a T A 2: 79,868,307 D393V probably damaging Het
Pias4 T C 10: 81,154,363 D421G possibly damaging Het
Pign T C 1: 105,638,215 T362A possibly damaging Het
Pik3c2g A C 6: 139,844,042 K304Q probably damaging Het
Pkd2 T A 5: 104,486,806 W568R probably damaging Het
Pld2 T A 11: 70,544,184 I306N probably damaging Het
Plppr3 T C 10: 79,874,069 K9R probably damaging Het
Pramef6 T A 4: 143,895,491 R431S possibly damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptbp2 A T 3: 119,761,749 S23R probably damaging Het
Ptpn13 A G 5: 103,580,709 D2074G probably null Het
Rab34 T A 11: 78,191,255 L166H probably damaging Het
Rabgap1l T A 1: 160,645,310 R519S probably benign Het
Rasa1 A T 13: 85,226,572 L218* probably null Het
Reln A G 5: 22,044,962 probably null Het
Rer1 T C 4: 155,078,499 D94G possibly damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Samd3 T A 10: 26,271,856 C476* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Slc27a2 A G 2: 126,586,342 Y549C probably benign Het
Slc7a9 A G 7: 35,449,854 T7A probably benign Het
Slco4c1 C T 1: 96,842,499 G280D probably damaging Het
Snx19 T A 9: 30,433,576 V657E probably damaging Het
Spata31d1c A G 13: 65,035,876 M411V probably benign Het
Spice1 T A 16: 44,357,830 L72* probably null Het
Stard9 G T 2: 120,713,812 V4471L probably damaging Het
Syt14 A G 1: 192,901,835 L707P probably damaging Het
Tab1 T C 15: 80,153,668 I234T probably damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tbx4 T A 11: 85,914,523 S479R possibly damaging Het
Tssk5 C T 15: 76,372,893 R263Q probably benign Het
Ttn T C 2: 76,870,856 probably benign Het
Ugt2b5 T A 5: 87,139,630 Q226L probably benign Het
Ush2a C T 1: 188,715,064 S2483L probably benign Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Yeats4 G A 10: 117,215,731 T207I probably benign Het
Ythdc1 A G 5: 86,830,630 R561G probably damaging Het
Zbtb14 G A 17: 69,387,390 E28K possibly damaging Het
Zfp931 A T 2: 178,069,891 L21Q probably damaging Het
Zyg11b A C 4: 108,255,226 M415R probably damaging Het
Other mutations in Sipa1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Sipa1l3 APN 7 29354133 missense probably damaging 0.97
IGL00481:Sipa1l3 APN 7 29386108 missense probably damaging 0.99
IGL01071:Sipa1l3 APN 7 29324220 missense possibly damaging 0.88
IGL01300:Sipa1l3 APN 7 29399828 nonsense probably null
IGL01361:Sipa1l3 APN 7 29348687 missense probably damaging 1.00
IGL01380:Sipa1l3 APN 7 29331372 missense possibly damaging 0.94
IGL02083:Sipa1l3 APN 7 29387261 missense probably damaging 1.00
IGL02484:Sipa1l3 APN 7 29399531 missense probably damaging 1.00
IGL02542:Sipa1l3 APN 7 29388065 missense probably damaging 1.00
IGL02645:Sipa1l3 APN 7 29328980 splice site probably null
IGL03410:Sipa1l3 APN 7 29348539 missense probably damaging 1.00
P0014:Sipa1l3 UTSW 7 29383215 missense probably damaging 1.00
R0111:Sipa1l3 UTSW 7 29348318 missense probably damaging 0.99
R0309:Sipa1l3 UTSW 7 29348350 missense probably benign 0.01
R0554:Sipa1l3 UTSW 7 29388030 missense possibly damaging 0.90
R0624:Sipa1l3 UTSW 7 29387251 missense probably damaging 1.00
R0894:Sipa1l3 UTSW 7 29387291 nonsense probably null
R1468:Sipa1l3 UTSW 7 29322260 missense possibly damaging 0.87
R1468:Sipa1l3 UTSW 7 29322260 missense possibly damaging 0.87
R1550:Sipa1l3 UTSW 7 29383203 missense probably benign 0.00
R1850:Sipa1l3 UTSW 7 29339126 missense probably damaging 0.96
R1905:Sipa1l3 UTSW 7 29339167 missense possibly damaging 0.89
R1994:Sipa1l3 UTSW 7 29399611 missense probably benign 0.39
R2228:Sipa1l3 UTSW 7 29377939 nonsense probably null
R2267:Sipa1l3 UTSW 7 29399602 missense probably damaging 1.00
R2341:Sipa1l3 UTSW 7 29377635 missense probably damaging 0.98
R3914:Sipa1l3 UTSW 7 29400085 missense probably benign 0.28
R4197:Sipa1l3 UTSW 7 29400813 missense possibly damaging 0.81
R4559:Sipa1l3 UTSW 7 29332253 missense probably damaging 1.00
R4569:Sipa1l3 UTSW 7 29325862 missense probably damaging 1.00
R4783:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4784:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4785:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4823:Sipa1l3 UTSW 7 29371002 missense probably damaging 1.00
R5057:Sipa1l3 UTSW 7 29371193 missense probably damaging 1.00
R5084:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5085:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5086:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5918:Sipa1l3 UTSW 7 29397206 missense probably damaging 1.00
R5973:Sipa1l3 UTSW 7 29399524 missense probably benign 0.20
R6291:Sipa1l3 UTSW 7 29388133 missense probably damaging 1.00
R6299:Sipa1l3 UTSW 7 29366549 critical splice donor site probably null
R6828:Sipa1l3 UTSW 7 29339032 missense probably benign 0.17
R6914:Sipa1l3 UTSW 7 29386091 missense probably damaging 1.00
R6942:Sipa1l3 UTSW 7 29386091 missense probably damaging 1.00
R7102:Sipa1l3 UTSW 7 29348587 missense possibly damaging 0.74
R7225:Sipa1l3 UTSW 7 29399428 missense probably damaging 1.00
R7310:Sipa1l3 UTSW 7 29399696 missense probably benign
R7429:Sipa1l3 UTSW 7 29387206 missense probably benign 0.24
R7489:Sipa1l3 UTSW 7 29366702 missense probably damaging 1.00
R7789:Sipa1l3 UTSW 7 29377725 missense probably damaging 1.00
R8041:Sipa1l3 UTSW 7 29364220 missense probably damaging 1.00
Z1177:Sipa1l3 UTSW 7 29400434 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTTCCCTGTCCCAGAGATG -3'
(R):5'- GCCAAGTCCACAGAACTGTC -3'

Sequencing Primer
(F):5'- CACTTACTTCTTGCTGTCAGTGAAGG -3'
(R):5'- GAACTGTCTACCTCCACACGGG -3'
Posted On2014-07-14