Incidental Mutation 'R1907:Psme4'
ID 214491
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 039926-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1907 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30760922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 397 (V397A)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: V397A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: V397A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133430
Meta Mutation Damage Score 0.8178 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 98% (104/106)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 121,862,661 (GRCm39) S206R probably damaging Het
Abcc6 G T 7: 45,663,593 (GRCm39) A357E probably benign Het
Abhd13 T A 8: 10,038,170 (GRCm39) C256S probably benign Het
Actrt3 A G 3: 30,652,716 (GRCm39) V126A probably damaging Het
Adgrv1 A G 13: 81,740,670 (GRCm39) probably benign Het
Alyref2 A G 1: 171,331,838 (GRCm39) D205G probably damaging Het
Amigo3 G A 9: 107,930,835 (GRCm39) R86Q probably benign Het
Ankrd50 G C 3: 38,508,201 (GRCm39) P1389A probably damaging Het
Aoah A G 13: 21,094,264 (GRCm39) D183G probably damaging Het
Arap3 A T 18: 38,129,724 (GRCm39) S146T probably benign Het
Atp2c2 T C 8: 120,476,615 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,853,583 (GRCm39) V682M probably benign Het
Cacna1i T C 15: 80,259,465 (GRCm39) I1245T probably damaging Het
Card14 A G 11: 119,222,085 (GRCm39) N460S probably benign Het
Ceacam5 A G 7: 17,486,309 (GRCm39) D602G possibly damaging Het
Cecr2 T A 6: 120,738,121 (GRCm39) H921Q probably benign Het
Cyb5d1 T C 11: 69,285,566 (GRCm39) D115G probably benign Het
Dbp C T 7: 45,357,744 (GRCm39) T67I possibly damaging Het
Dennd5b C T 6: 148,943,074 (GRCm39) V601I probably benign Het
Dnah11 G A 12: 118,091,291 (GRCm39) A947V possibly damaging Het
Dpysl3 T A 18: 43,571,193 (GRCm39) D27V probably damaging Het
Drd1 A T 13: 54,207,271 (GRCm39) D307E possibly damaging Het
Dscaml1 G A 9: 45,651,778 (GRCm39) G277D probably damaging Het
Eif4g3 C T 4: 137,885,726 (GRCm39) R842W probably damaging Het
Enam C T 5: 88,652,481 (GRCm39) T1330I possibly damaging Het
Fabp6 T C 11: 43,486,994 (GRCm39) probably null Het
Fcsk A T 8: 111,620,010 (GRCm39) L289* probably null Het
Fhip1a T C 3: 85,579,940 (GRCm39) D755G probably benign Het
Fsip2 C T 2: 82,813,772 (GRCm39) P3364S possibly damaging Het
Gad1 C T 2: 70,409,482 (GRCm39) S191F possibly damaging Het
Gcm1 A C 9: 77,972,055 (GRCm39) N332T probably benign Het
Gin1 G A 1: 97,703,172 (GRCm39) probably benign Het
Gpr25 T C 1: 136,188,538 (GRCm39) D25G probably benign Het
Gstm4 T C 3: 107,948,593 (GRCm39) T172A probably benign Het
Hnrnpll A G 17: 80,342,758 (GRCm39) probably null Het
Il12rb2 T A 6: 67,272,270 (GRCm39) K339* probably null Het
Inpp1 A G 1: 52,828,829 (GRCm39) *397Q probably null Het
Kcp G T 6: 29,497,834 (GRCm39) probably benign Het
Kdm1b G A 13: 47,217,596 (GRCm39) V352I probably benign Het
Klhdc2 G T 12: 69,343,734 (GRCm39) probably benign Het
Krt75 T A 15: 101,481,801 (GRCm39) T156S possibly damaging Het
Lag3 T A 6: 124,886,450 (GRCm39) I168F possibly damaging Het
Lama4 T G 10: 38,948,754 (GRCm39) V839G probably benign Het
Lmtk2 G T 5: 144,111,928 (GRCm39) V883L probably benign Het
Lrrc37a C A 11: 103,347,982 (GRCm39) K2904N unknown Het
Macf1 A T 4: 123,266,192 (GRCm39) I4775N probably damaging Het
Map2k3 T G 11: 60,823,055 (GRCm39) S3A possibly damaging Het
Mast1 G A 8: 85,642,895 (GRCm39) R967C probably damaging Het
Mettl2 T G 11: 105,017,666 (GRCm39) S59A probably benign Het
Mtr G A 13: 12,240,418 (GRCm39) T530I probably damaging Het
Myo7b A T 18: 32,110,052 (GRCm39) C1137S possibly damaging Het
Nacad T A 11: 6,552,540 (GRCm39) H217L probably benign Het
Ncstn A T 1: 171,899,710 (GRCm39) V324E probably damaging Het
Ndufaf7 C A 17: 79,249,546 (GRCm39) H148N possibly damaging Het
Or10a49 T A 7: 108,467,705 (GRCm39) I219F possibly damaging Het
Or52a24 T A 7: 103,381,190 (GRCm39) I19N probably damaging Het
Or52n2b G A 7: 104,566,272 (GRCm39) T77I probably damaging Het
Or7g12 T C 9: 18,899,737 (GRCm39) I151T possibly damaging Het
Or8b12 T G 9: 37,657,729 (GRCm39) L100V probably benign Het
Or8k17 T C 2: 86,066,454 (GRCm39) K242E possibly damaging Het
Pcdh20 T C 14: 88,706,140 (GRCm39) I387V probably benign Het
Pclo A G 5: 14,728,525 (GRCm39) probably benign Het
Pcp2 G A 8: 3,674,904 (GRCm39) probably benign Het
Pde1a T A 2: 79,698,651 (GRCm39) D393V probably damaging Het
Pias4 T C 10: 80,990,197 (GRCm39) D421G possibly damaging Het
Pign T C 1: 105,565,940 (GRCm39) T362A possibly damaging Het
Pik3c2g A C 6: 139,789,768 (GRCm39) K304Q probably damaging Het
Pkd2 T A 5: 104,634,672 (GRCm39) W568R probably damaging Het
Pld2 T A 11: 70,435,010 (GRCm39) I306N probably damaging Het
Plppr3 T C 10: 79,709,903 (GRCm39) K9R probably damaging Het
Pramel11 T A 4: 143,622,061 (GRCm39) R431S possibly damaging Het
Ptbp2 A T 3: 119,555,398 (GRCm39) S23R probably damaging Het
Ptpn13 A G 5: 103,728,575 (GRCm39) D2074G probably null Het
Rab34 T A 11: 78,082,081 (GRCm39) L166H probably damaging Het
Rabgap1l T A 1: 160,472,880 (GRCm39) R519S probably benign Het
Rasa1 A T 13: 85,374,691 (GRCm39) L218* probably null Het
Reln A G 5: 22,249,960 (GRCm39) probably null Het
Rer1 T C 4: 155,162,956 (GRCm39) D94G possibly damaging Het
Rhpn1 T C 15: 75,583,673 (GRCm39) V386A probably benign Het
Samd3 T A 10: 26,147,754 (GRCm39) C476* probably null Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sipa1l3 A G 7: 29,038,592 (GRCm39) S352P possibly damaging Het
Slc27a2 A G 2: 126,428,262 (GRCm39) Y549C probably benign Het
Slc7a9 A G 7: 35,149,279 (GRCm39) T7A probably benign Het
Slco4c1 C T 1: 96,770,224 (GRCm39) G280D probably damaging Het
Snx19 T A 9: 30,344,872 (GRCm39) V657E probably damaging Het
Spata31d1c A G 13: 65,183,690 (GRCm39) M411V probably benign Het
Spice1 T A 16: 44,178,193 (GRCm39) L72* probably null Het
Stard9 G T 2: 120,544,293 (GRCm39) V4471L probably damaging Het
Syt14 A G 1: 192,584,143 (GRCm39) L707P probably damaging Het
Tab1 T C 15: 80,037,869 (GRCm39) I234T probably damaging Het
Tas2r107 T C 6: 131,636,951 (GRCm39) M33V probably benign Het
Tbx4 T A 11: 85,805,349 (GRCm39) S479R possibly damaging Het
Tssk5 C T 15: 76,257,093 (GRCm39) R263Q probably benign Het
Ttn T C 2: 76,701,200 (GRCm39) probably benign Het
Ugt2b5 T A 5: 87,287,489 (GRCm39) Q226L probably benign Het
Ush2a C T 1: 188,447,261 (GRCm39) S2483L probably benign Het
Wdr95 A G 5: 149,475,891 (GRCm39) Y63C probably damaging Het
Xirp2 A G 2: 67,346,700 (GRCm39) I2980M probably damaging Het
Yeats4 G A 10: 117,051,636 (GRCm39) T207I probably benign Het
Ythdc1 A G 5: 86,978,489 (GRCm39) R561G probably damaging Het
Zbtb14 G A 17: 69,694,385 (GRCm39) E28K possibly damaging Het
Zfp931 A T 2: 177,711,684 (GRCm39) L21Q probably damaging Het
Zyg11b A C 4: 108,112,423 (GRCm39) M415R probably damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAACCTGAGTAGAACCTATTG -3'
(R):5'- GTACAGAAGACATATGTAAGCACTG -3'

Sequencing Primer
(F):5'- AGAACCTATTGTTTCTATGTTCCCAG -3'
(R):5'- ACATGTGTGCCTGGTACCCAC -3'
Posted On 2014-07-14