Incidental Mutation 'R1907:Psme4'
ID 214491
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 039926-MU
Accession Numbers

Genbank: NM_134013

Essential gene? Non essential (E-score: 0.000) question?
Stock # R1907 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 30771726-30880361 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30810922 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 397 (V397A)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: V397A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: V397A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133430
Meta Mutation Damage Score 0.8178 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 98% (104/106)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,069,012 S206R probably damaging Het
Abcc6 G T 7: 46,014,169 A357E probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Actrt3 A G 3: 30,598,567 V126A probably damaging Het
Adgrv1 A G 13: 81,592,551 probably benign Het
Alyref2 A G 1: 171,504,270 D205G probably damaging Het
Amigo3 G A 9: 108,053,636 R86Q probably benign Het
Ankrd50 G C 3: 38,454,052 P1389A probably damaging Het
Aoah A G 13: 20,910,094 D183G probably damaging Het
Arap3 A T 18: 37,996,671 S146T probably benign Het
Atp2c2 T C 8: 119,749,876 probably benign Het
Atp8b2 C T 3: 89,946,276 V682M probably benign Het
Cacna1i T C 15: 80,375,264 I1245T probably damaging Het
Card14 A G 11: 119,331,259 N460S probably benign Het
Ceacam5 A G 7: 17,752,384 D602G possibly damaging Het
Cecr2 T A 6: 120,761,160 H921Q probably benign Het
Cyb5d1 T C 11: 69,394,740 D115G probably benign Het
Dbp C T 7: 45,708,320 T67I possibly damaging Het
Dennd5b C T 6: 149,041,576 V601I probably benign Het
Dnah11 G A 12: 118,127,556 A947V possibly damaging Het
Dpysl3 T A 18: 43,438,128 D27V probably damaging Het
Drd1 A T 13: 54,053,252 D307E possibly damaging Het
Dscaml1 G A 9: 45,740,480 G277D probably damaging Het
Eif4g3 C T 4: 138,158,415 R842W probably damaging Het
Enam C T 5: 88,504,622 T1330I possibly damaging Het
Fabp6 T C 11: 43,596,167 probably null Het
Fam160a1 T C 3: 85,672,633 D755G probably benign Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fuk A T 8: 110,893,378 L289* probably null Het
Gad1 C T 2: 70,579,138 S191F possibly damaging Het
Gcm1 A C 9: 78,064,773 N332T probably benign Het
Gin1 G A 1: 97,775,447 probably benign Het
Gpr25 T C 1: 136,260,800 D25G probably benign Het
Gstm4 T C 3: 108,041,277 T172A probably benign Het
Hnrnpll A G 17: 80,035,329 probably null Het
Il12rb2 T A 6: 67,295,286 K339* probably null Het
Inpp1 A G 1: 52,789,670 *397Q probably null Het
Kcp G T 6: 29,497,835 probably benign Het
Kdm1b G A 13: 47,064,120 V352I probably benign Het
Klhdc2 G T 12: 69,296,960 probably benign Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lag3 T A 6: 124,909,487 I168F possibly damaging Het
Lama4 T G 10: 39,072,758 V839G probably benign Het
Lmtk2 G T 5: 144,175,110 V883L probably benign Het
Lrrc37a C A 11: 103,457,156 K2904N unknown Het
Macf1 A T 4: 123,372,399 I4775N probably damaging Het
Map2k3 T G 11: 60,932,229 S3A possibly damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mettl2 T G 11: 105,126,840 S59A probably benign Het
Mtr G A 13: 12,225,532 T530I probably damaging Het
Myo7b A T 18: 31,976,999 C1137S possibly damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncstn A T 1: 172,072,143 V324E probably damaging Het
Ndufaf7 C A 17: 78,942,117 H148N possibly damaging Het
Olfr1048 T C 2: 86,236,110 K242E possibly damaging Het
Olfr517 T A 7: 108,868,498 I219F possibly damaging Het
Olfr628 T A 7: 103,731,983 I19N probably damaging Het
Olfr667 G A 7: 104,917,065 T77I probably damaging Het
Olfr834 T C 9: 18,988,441 I151T possibly damaging Het
Olfr874 T G 9: 37,746,433 L100V probably benign Het
Pcdh20 T C 14: 88,468,704 I387V probably benign Het
Pclo A G 5: 14,678,511 probably benign Het
Pcp2 G A 8: 3,624,904 probably benign Het
Pde1a T A 2: 79,868,307 D393V probably damaging Het
Pias4 T C 10: 81,154,363 D421G possibly damaging Het
Pign T C 1: 105,638,215 T362A possibly damaging Het
Pik3c2g A C 6: 139,844,042 K304Q probably damaging Het
Pkd2 T A 5: 104,486,806 W568R probably damaging Het
Pld2 T A 11: 70,544,184 I306N probably damaging Het
Plppr3 T C 10: 79,874,069 K9R probably damaging Het
Pramef6 T A 4: 143,895,491 R431S possibly damaging Het
Ptbp2 A T 3: 119,761,749 S23R probably damaging Het
Ptpn13 A G 5: 103,580,709 D2074G probably null Het
Rab34 T A 11: 78,191,255 L166H probably damaging Het
Rabgap1l T A 1: 160,645,310 R519S probably benign Het
Rasa1 A T 13: 85,226,572 L218* probably null Het
Reln A G 5: 22,044,962 probably null Het
Rer1 T C 4: 155,078,499 D94G possibly damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Samd3 T A 10: 26,271,856 C476* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc27a2 A G 2: 126,586,342 Y549C probably benign Het
Slc7a9 A G 7: 35,449,854 T7A probably benign Het
Slco4c1 C T 1: 96,842,499 G280D probably damaging Het
Snx19 T A 9: 30,433,576 V657E probably damaging Het
Spata31d1c A G 13: 65,035,876 M411V probably benign Het
Spice1 T A 16: 44,357,830 L72* probably null Het
Stard9 G T 2: 120,713,812 V4471L probably damaging Het
Syt14 A G 1: 192,901,835 L707P probably damaging Het
Tab1 T C 15: 80,153,668 I234T probably damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tbx4 T A 11: 85,914,523 S479R possibly damaging Het
Tssk5 C T 15: 76,372,893 R263Q probably benign Het
Ttn T C 2: 76,870,856 probably benign Het
Ugt2b5 T A 5: 87,139,630 Q226L probably benign Het
Ush2a C T 1: 188,715,064 S2483L probably benign Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Yeats4 G A 10: 117,215,731 T207I probably benign Het
Ythdc1 A G 5: 86,830,630 R561G probably damaging Het
Zbtb14 G A 17: 69,387,390 E28K possibly damaging Het
Zfp931 A T 2: 178,069,891 L21Q probably damaging Het
Zyg11b A C 4: 108,255,226 M415R probably damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8323:Psme4 UTSW 11 30843532 missense probably damaging 0.99
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
R8491:Psme4 UTSW 11 30772161 missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30837319 missense probably benign 0.00
R8696:Psme4 UTSW 11 30809896 missense probably damaging 0.99
R8743:Psme4 UTSW 11 30878467 missense probably damaging 1.00
R8998:Psme4 UTSW 11 30838957 missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30865576 missense probably damaging 1.00
R9657:Psme4 UTSW 11 30838980 missense probably benign 0.00
R9736:Psme4 UTSW 11 30847411 missense probably damaging 0.99
R9744:Psme4 UTSW 11 30815294 critical splice donor site probably null
R9746:Psme4 UTSW 11 30876868 nonsense probably null
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAACCTGAGTAGAACCTATTG -3'
(R):5'- GTACAGAAGACATATGTAAGCACTG -3'

Sequencing Primer
(F):5'- AGAACCTATTGTTTCTATGTTCCCAG -3'
(R):5'- ACATGTGTGCCTGGTACCCAC -3'
Posted On 2014-07-14