Incidental Mutation 'R1913:Zc3h6'
ID 214532
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms 4631426G04Rik, 4833425H18Rik
MMRRC Submission 039931-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R1913 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 128809322-128860483 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128858540 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 857 (I857T)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110320
AA Change: I857T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: I857T

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135186
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,140,463 (GRCm39) I1588F probably benign Het
Abcc2 A T 19: 43,795,683 (GRCm39) T480S probably benign Het
Acnat1 A G 4: 49,447,498 (GRCm39) I361T probably damaging Het
Adamts10 A T 17: 33,768,529 (GRCm39) H869L probably benign Het
Agpat5 T C 8: 18,929,629 (GRCm39) C253R probably benign Het
Agtrap T A 4: 148,168,434 (GRCm39) H15L probably damaging Het
Ahnak T A 19: 8,985,286 (GRCm39) V2190E probably damaging Het
Alx4 A G 2: 93,505,732 (GRCm39) E278G probably damaging Het
Amz2 T C 11: 109,319,697 (GRCm39) S28P probably damaging Het
Atr T A 9: 95,748,786 (GRCm39) Y444N probably benign Het
Brdt T C 5: 107,496,479 (GRCm39) I197T probably benign Het
Ccser1 G T 6: 62,356,878 (GRCm39) S772I probably damaging Het
Cdh16 T C 8: 105,343,100 (GRCm39) H657R probably benign Het
Ceacam5 A T 7: 17,493,502 (GRCm39) K842* probably null Het
Cep120 G A 18: 53,856,358 (GRCm39) T353I probably benign Het
Chrnb1 T C 11: 69,684,410 (GRCm39) N164S possibly damaging Het
Cse1l T C 2: 166,764,111 (GRCm39) F123L probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dcx G C X: 142,706,099 (GRCm39) L231V probably damaging Het
Dnah12 T C 14: 26,514,221 (GRCm39) probably null Het
Dnah2 A T 11: 69,355,756 (GRCm39) M2227K probably damaging Het
Dnajc30 G A 5: 135,093,186 (GRCm39) A28T probably benign Het
Dnm1l T C 16: 16,147,830 (GRCm39) T306A probably benign Het
Elapor2 T G 5: 9,316,275 (GRCm39) L2R probably damaging Het
Enpp3 C A 10: 24,652,669 (GRCm39) E763* probably null Het
Esyt3 T C 9: 99,202,364 (GRCm39) S516G probably benign Het
Exoc3 T C 13: 74,330,435 (GRCm39) Q498R probably damaging Het
Fbn2 T A 18: 58,194,814 (GRCm39) N1449I probably damaging Het
Fgb T C 3: 82,952,287 (GRCm39) D194G probably benign Het
Fgd3 T C 13: 49,417,324 (GRCm39) D713G possibly damaging Het
Foxb1 T A 9: 69,667,383 (GRCm39) Y49F possibly damaging Het
Fpr3 A G 17: 18,191,670 (GRCm39) I314V probably damaging Het
Gfod1 A T 13: 43,456,921 (GRCm39) I18N probably damaging Het
Gm5407 T C 16: 49,117,283 (GRCm39) noncoding transcript Het
Gpr89 A G 3: 96,782,949 (GRCm39) F334L possibly damaging Het
Gucy2d G T 7: 98,093,054 (GRCm39) V144F probably benign Het
H2-M10.5 C A 17: 37,085,660 (GRCm39) P273H probably damaging Het
H2-T13 T A 17: 36,391,908 (GRCm39) K237M probably damaging Het
Hcn2 A G 10: 79,566,777 (GRCm39) M485V probably benign Het
Helz2 G T 2: 180,875,543 (GRCm39) S1650R probably damaging Het
Ifnar2 T C 16: 91,201,058 (GRCm39) V433A probably benign Het
Igsf21 T A 4: 139,834,623 (GRCm39) Y83F probably benign Het
Kcnk18 A G 19: 59,223,490 (GRCm39) I212V possibly damaging Het
Kcns2 T C 15: 34,839,855 (GRCm39) I406T probably damaging Het
Krt42 C T 11: 100,158,075 (GRCm39) V166M possibly damaging Het
Lama3 T C 18: 12,628,336 (GRCm39) M1476T probably benign Het
Lcor A G 19: 41,546,913 (GRCm39) R166G probably benign Het
Mapt C T 11: 104,218,901 (GRCm39) P354L probably damaging Het
Mep1b A T 18: 21,226,286 (GRCm39) I383F probably benign Het
Mpzl1 C A 1: 165,429,374 (GRCm39) C222F probably benign Het
Mug2 T C 6: 122,047,829 (GRCm39) L780P probably damaging Het
Naip2 C T 13: 100,288,665 (GRCm39) probably null Het
Ndufab1 T C 7: 121,695,914 (GRCm39) D41G probably benign Het
Ntn1 A G 11: 68,104,011 (GRCm39) C546R probably damaging Het
Or2a5 T A 6: 42,873,687 (GRCm39) F101I probably damaging Het
Pakap A G 4: 57,892,963 (GRCm39) E880G probably damaging Het
Pde6b A G 5: 108,575,056 (GRCm39) E639G probably benign Het
Phf10 T C 17: 15,177,071 (GRCm39) T83A probably benign Het
Phkb T A 8: 86,628,549 (GRCm39) I186N possibly damaging Het
Pkhd1 A G 1: 20,636,980 (GRCm39) probably null Het
Plxnd1 C A 6: 115,954,978 (GRCm39) A595S possibly damaging Het
Ppara T A 15: 85,685,300 (GRCm39) H416Q probably damaging Het
Prodh T A 16: 17,898,891 (GRCm39) D188V probably damaging Het
Psmd14 A T 2: 61,615,800 (GRCm39) K223M possibly damaging Het
Ptpn5 A G 7: 46,728,616 (GRCm39) M528T possibly damaging Het
Rassf9 G A 10: 102,380,800 (GRCm39) E59K probably benign Het
Rnf2 A T 1: 151,351,936 (GRCm39) L140H probably damaging Het
Scai A G 2: 38,970,093 (GRCm39) F557S probably damaging Het
Sdk2 A G 11: 113,747,552 (GRCm39) S653P possibly damaging Het
Sec24c A G 14: 20,739,179 (GRCm39) D534G probably benign Het
Semp2l2a T A 8: 13,887,143 (GRCm39) Q316L probably benign Het
Septin4 T C 11: 87,457,838 (GRCm39) S71P probably benign Het
Serinc1 A G 10: 57,395,561 (GRCm39) V375A probably benign Het
Serpinb9f C T 13: 33,509,829 (GRCm39) A7V probably damaging Het
Smco1 T C 16: 32,092,700 (GRCm39) S124P probably damaging Het
Smim23 C A 11: 32,774,441 (GRCm39) C26F possibly damaging Het
Sppl2c T A 11: 104,078,715 (GRCm39) M505K probably benign Het
Sprr1b C A 3: 92,344,775 (GRCm39) V34F possibly damaging Het
Sun1 G A 5: 139,221,487 (GRCm39) probably null Het
Supt16 A G 14: 52,415,592 (GRCm39) L381P possibly damaging Het
Syne2 A G 12: 75,946,020 (GRCm39) D364G possibly damaging Het
Tax1bp1 G T 6: 52,742,937 (GRCm39) V775F probably damaging Het
Tial1 T A 7: 128,046,383 (GRCm39) I231F probably damaging Het
Tiam1 C A 16: 89,595,582 (GRCm39) V1300L probably damaging Het
Tmem132e A G 11: 82,334,243 (GRCm39) T585A probably damaging Het
Tnni3k C T 3: 154,684,836 (GRCm39) A165T probably benign Het
Tomm40 A T 7: 19,444,886 (GRCm39) I165N probably damaging Het
Tomt T C 7: 101,550,454 (GRCm39) E104G probably damaging Het
Topaz1 T C 9: 122,596,078 (GRCm39) S950P possibly damaging Het
Traf3ip2 C G 10: 39,501,936 (GRCm39) P28R probably benign Het
Trim24 C T 6: 37,934,750 (GRCm39) P822S probably damaging Het
Upf3a T G 8: 13,842,108 (GRCm39) Y175D probably damaging Het
Vars2 G A 17: 35,977,814 (GRCm39) P69S probably benign Het
Veph1 T C 3: 66,151,976 (GRCm39) Y151C probably damaging Het
Vmn2r11 T A 5: 109,202,654 (GRCm39) D141V probably benign Het
Vwa5b1 G A 4: 138,319,331 (GRCm39) Q442* probably null Het
Wdr17 T A 8: 55,140,761 (GRCm39) D197V probably damaging Het
Wdr70 G T 15: 7,913,891 (GRCm39) T586N possibly damaging Het
Wfdc18 G A 11: 83,600,754 (GRCm39) G52R probably benign Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,723,440 (GRCm39) probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,723,450 (GRCm39) probably benign Het
Zfp647 C T 15: 76,796,151 (GRCm39) V170I probably benign Het
Zfp871 T C 17: 32,994,891 (GRCm39) N76D possibly damaging Het
Zpld2 A G 4: 133,919,986 (GRCm39) probably null Het
Zwilch A G 9: 64,068,234 (GRCm39) Y194H probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 128,853,795 (GRCm39) missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 128,859,298 (GRCm39) missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128,839,605 (GRCm39) missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128,835,146 (GRCm39) missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 128,858,501 (GRCm39) missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 128,857,531 (GRCm39) missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128,839,715 (GRCm39) missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 128,857,332 (GRCm39) missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 128,856,747 (GRCm39) missense probably benign 0.00
R0538:Zc3h6 UTSW 2 128,859,143 (GRCm39) missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 128,848,736 (GRCm39) missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 128,859,056 (GRCm39) missense probably benign 0.00
R1528:Zc3h6 UTSW 2 128,858,989 (GRCm39) missense probably benign 0.01
R1698:Zc3h6 UTSW 2 128,859,278 (GRCm39) missense probably benign
R1712:Zc3h6 UTSW 2 128,858,654 (GRCm39) missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128,839,715 (GRCm39) missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 128,848,006 (GRCm39) missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 128,857,538 (GRCm39) missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128,809,750 (GRCm39) missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 128,856,629 (GRCm39) missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128,835,122 (GRCm39) missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 128,857,380 (GRCm39) missense probably benign 0.43
R2899:Zc3h6 UTSW 2 128,844,152 (GRCm39) missense probably benign 0.00
R3711:Zc3h6 UTSW 2 128,859,251 (GRCm39) missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128,839,712 (GRCm39) missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 128,858,060 (GRCm39) missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 128,844,160 (GRCm39) missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 128,852,353 (GRCm39) missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 128,859,229 (GRCm39) missense probably benign 0.00
R5125:Zc3h6 UTSW 2 128,856,399 (GRCm39) missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128,835,372 (GRCm39) intron probably benign
R5802:Zc3h6 UTSW 2 128,857,479 (GRCm39) missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128,835,197 (GRCm39) missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128,839,696 (GRCm39) splice site probably null
R5950:Zc3h6 UTSW 2 128,839,710 (GRCm39) nonsense probably null
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 128,857,341 (GRCm39) missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128,835,331 (GRCm39) missense unknown
R7340:Zc3h6 UTSW 2 128,835,110 (GRCm39) missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 128,859,172 (GRCm39) missense probably benign 0.02
R7576:Zc3h6 UTSW 2 128,856,473 (GRCm39) missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 128,857,555 (GRCm39) critical splice donor site probably null
R7924:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 128,858,934 (GRCm39) missense probably benign 0.30
R8877:Zc3h6 UTSW 2 128,856,319 (GRCm39) nonsense probably null
R9076:Zc3h6 UTSW 2 128,859,096 (GRCm39) nonsense probably null
R9577:Zc3h6 UTSW 2 128,858,102 (GRCm39) missense
R9687:Zc3h6 UTSW 2 128,859,281 (GRCm39) missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 128,859,155 (GRCm39) missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 128,858,141 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGAGCAGAGTTTGACTTACGTC -3'
(R):5'- AGACTCAGTTTGGCTTTGGC -3'

Sequencing Primer
(F):5'- CGTCATACAAATGCTGGTGC -3'
(R):5'- TTGGATCAAGGCTCAGGGCAC -3'
Posted On 2014-07-14