Incidental Mutation 'R1913:Zc3h6'
ID214532
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Namezinc finger CCCH type containing 6
Synonyms
MMRRC Submission 039931-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R1913 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location128967402-129018563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129016620 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 857 (I857T)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
Predicted Effect probably damaging
Transcript: ENSMUST00000110320
AA Change: I857T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: I857T

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135186
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T G 5: 9,266,275 L2R probably damaging Het
Abca16 A T 7: 120,541,240 I1588F probably benign Het
Abcc2 A T 19: 43,807,244 T480S probably benign Het
Acnat1 A G 4: 49,447,498 I361T probably damaging Het
Adamts10 A T 17: 33,549,555 H869L probably benign Het
AF366264 T A 8: 13,837,143 Q316L probably benign Het
Agpat5 T C 8: 18,879,613 C253R probably benign Het
Agtrap T A 4: 148,083,977 H15L probably damaging Het
Ahnak T A 19: 9,007,922 V2190E probably damaging Het
Alx4 A G 2: 93,675,387 E278G probably damaging Het
Amz2 T C 11: 109,428,871 S28P probably damaging Het
Atr T A 9: 95,866,733 Y444N probably benign Het
Brdt T C 5: 107,348,613 I197T probably benign Het
Ccser1 G T 6: 62,379,894 S772I probably damaging Het
Cdh16 T C 8: 104,616,468 H657R probably benign Het
Ceacam5 A T 7: 17,759,577 K842* probably null Het
Cep120 G A 18: 53,723,286 T353I probably benign Het
Chrnb1 T C 11: 69,793,584 N164S possibly damaging Het
Cse1l T C 2: 166,922,191 F123L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dcx G C X: 143,923,103 L231V probably damaging Het
Dnah12 T C 14: 26,792,264 probably null Het
Dnah2 A T 11: 69,464,930 M2227K probably damaging Het
Dnajc30 G A 5: 135,064,332 A28T probably benign Het
Dnm1l T C 16: 16,329,966 T306A probably benign Het
Enpp3 C A 10: 24,776,771 E763* probably null Het
Esyt3 T C 9: 99,320,311 S516G probably benign Het
Exoc3 T C 13: 74,182,316 Q498R probably damaging Het
Fbn2 T A 18: 58,061,742 N1449I probably damaging Het
Fgb T C 3: 83,044,980 D194G probably benign Het
Fgd3 T C 13: 49,263,848 D713G possibly damaging Het
Foxb1 T A 9: 69,760,101 Y49F possibly damaging Het
Fpr3 A G 17: 17,971,408 I314V probably damaging Het
Gfod1 A T 13: 43,303,445 I18N probably damaging Het
Gm11492 T C 11: 87,567,012 S71P probably benign Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm7534 A G 4: 134,192,675 probably null Het
Gpr89 A G 3: 96,875,633 F334L possibly damaging Het
Gucy2d G T 7: 98,443,847 V144F probably benign Het
H2-Bl T A 17: 36,081,016 K237M probably damaging Het
H2-M10.5 C A 17: 36,774,768 P273H probably damaging Het
Hcn2 A G 10: 79,730,943 M485V probably benign Het
Helz2 G T 2: 181,233,750 S1650R probably damaging Het
Ifnar2 T C 16: 91,404,170 V433A probably benign Het
Igsf21 T A 4: 140,107,312 Y83F probably benign Het
Kcnk18 A G 19: 59,235,058 I212V possibly damaging Het
Kcns2 T C 15: 34,839,709 I406T probably damaging Het
Krt42 C T 11: 100,267,249 V166M possibly damaging Het
Lama3 T C 18: 12,495,279 M1476T probably benign Het
Lcor A G 19: 41,558,474 R166G probably benign Het
Mapt C T 11: 104,328,075 P354L probably damaging Het
Mep1b A T 18: 21,093,229 I383F probably benign Het
Mpzl1 C A 1: 165,601,805 C222F probably benign Het
Mug2 T C 6: 122,070,870 L780P probably damaging Het
Naip2 C T 13: 100,152,157 probably null Het
Ndufab1 T C 7: 122,096,691 D41G probably benign Het
Ntn1 A G 11: 68,213,185 C546R probably damaging Het
Olfr448 T A 6: 42,896,753 F101I probably damaging Het
Pakap A G 4: 57,892,963 E880G probably damaging Het
Pde6b A G 5: 108,427,190 E639G probably benign Het
Phf10 T C 17: 14,956,809 T83A probably benign Het
Phkb T A 8: 85,901,920 I186N possibly damaging Het
Pkhd1 A G 1: 20,566,756 probably null Het
Plxnd1 C A 6: 115,978,017 A595S possibly damaging Het
Ppara T A 15: 85,801,099 H416Q probably damaging Het
Prodh T A 16: 18,081,027 D188V probably damaging Het
Psmd14 A T 2: 61,785,456 K223M possibly damaging Het
Ptpn5 A G 7: 47,078,868 M528T possibly damaging Het
Rassf9 G A 10: 102,544,939 E59K probably benign Het
Rnf2 A T 1: 151,476,185 L140H probably damaging Het
Scai A G 2: 39,080,081 F557S probably damaging Het
Sdk2 A G 11: 113,856,726 S653P possibly damaging Het
Sec24c A G 14: 20,689,111 D534G probably benign Het
Serinc1 A G 10: 57,519,465 V375A probably benign Het
Serpinb9f C T 13: 33,325,846 A7V probably damaging Het
Smco1 T C 16: 32,273,882 S124P probably damaging Het
Smim23 C A 11: 32,824,441 C26F possibly damaging Het
Sppl2c T A 11: 104,187,889 M505K probably benign Het
Sprr1b C A 3: 92,437,468 V34F possibly damaging Het
Sun1 G A 5: 139,235,732 probably null Het
Supt16 A G 14: 52,178,135 L381P possibly damaging Het
Syne2 A G 12: 75,899,246 D364G possibly damaging Het
Tax1bp1 G T 6: 52,765,952 V775F probably damaging Het
Tial1 T A 7: 128,444,659 I231F probably damaging Het
Tiam1 C A 16: 89,798,694 V1300L probably damaging Het
Tmem132e A G 11: 82,443,417 T585A probably damaging Het
Tnni3k C T 3: 154,979,199 A165T probably benign Het
Tomm40 A T 7: 19,710,961 I165N probably damaging Het
Tomt T C 7: 101,901,247 E104G probably damaging Het
Topaz1 T C 9: 122,767,013 S950P possibly damaging Het
Traf3ip2 C G 10: 39,625,940 P28R probably benign Het
Trim24 C T 6: 37,957,815 P822S probably damaging Het
Upf3a T G 8: 13,792,108 Y175D probably damaging Het
Vars2 G A 17: 35,666,922 P69S probably benign Het
Veph1 T C 3: 66,244,555 Y151C probably damaging Het
Vmn2r11 T A 5: 109,054,788 D141V probably benign Het
Vwa5b1 G A 4: 138,592,020 Q442* probably null Het
Wdr17 T A 8: 54,687,726 D197V probably damaging Het
Wdr70 G T 15: 7,884,410 T586N possibly damaging Het
Wfdc18 G A 11: 83,709,928 G52R probably benign Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,412,524 probably benign Het
Zfp647 C T 15: 76,911,951 V170I probably benign Het
Zfp871 T C 17: 32,775,917 N76D possibly damaging Het
Zwilch A G 9: 64,160,952 Y194H probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 unclassified probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 129017252 missense probably benign 0.02
R7576:Zc3h6 UTSW 2 129014553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGCAGAGTTTGACTTACGTC -3'
(R):5'- AGACTCAGTTTGGCTTTGGC -3'

Sequencing Primer
(F):5'- CGTCATACAAATGCTGGTGC -3'
(R):5'- TTGGATCAAGGCTCAGGGCAC -3'
Posted On2014-07-14