Incidental Mutation 'R1913:Brdt'
ID 214550
Institutional Source Beutler Lab
Gene Symbol Brdt
Ensembl Gene ENSMUSG00000029279
Gene Name bromodomain, testis-specific
Synonyms Fsrg3, 7420412D09Rik, Brd6
MMRRC Submission 039931-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1913 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 107331159-107387058 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107348613 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 197 (I197T)
Ref Sequence ENSEMBL: ENSMUSP00000108297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031215] [ENSMUST00000112677]
AlphaFold Q91Y44
Predicted Effect probably benign
Transcript: ENSMUST00000031215
AA Change: I197T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: I197T

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
BROMO 268 377 2.18e-40 SMART
low complexity region 392 417 N/A INTRINSIC
low complexity region 446 455 N/A INTRINSIC
low complexity region 472 500 N/A INTRINSIC
Pfam:BET 505 569 9.2e-34 PFAM
low complexity region 585 603 N/A INTRINSIC
low complexity region 649 691 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
Pfam:BRD4_CDT 913 956 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112677
AA Change: I197T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108297
Gene: ENSMUSG00000029279
AA Change: I197T

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
Pfam:Bromodomain 275 326 2.7e-8 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T G 5: 9,266,275 (GRCm38) L2R probably damaging Het
Abca16 A T 7: 120,541,240 (GRCm38) I1588F probably benign Het
Abcc2 A T 19: 43,807,244 (GRCm38) T480S probably benign Het
Acnat1 A G 4: 49,447,498 (GRCm38) I361T probably damaging Het
Adamts10 A T 17: 33,549,555 (GRCm38) H869L probably benign Het
AF366264 T A 8: 13,837,143 (GRCm38) Q316L probably benign Het
Agpat5 T C 8: 18,879,613 (GRCm38) C253R probably benign Het
Agtrap T A 4: 148,083,977 (GRCm38) H15L probably damaging Het
Ahnak T A 19: 9,007,922 (GRCm38) V2190E probably damaging Het
Alx4 A G 2: 93,675,387 (GRCm38) E278G probably damaging Het
Amz2 T C 11: 109,428,871 (GRCm38) S28P probably damaging Het
Atr T A 9: 95,866,733 (GRCm38) Y444N probably benign Het
Ccser1 G T 6: 62,379,894 (GRCm38) S772I probably damaging Het
Cdh16 T C 8: 104,616,468 (GRCm38) H657R probably benign Het
Ceacam5 A T 7: 17,759,577 (GRCm38) K842* probably null Het
Cep120 G A 18: 53,723,286 (GRCm38) T353I probably benign Het
Chrnb1 T C 11: 69,793,584 (GRCm38) N164S possibly damaging Het
Cse1l T C 2: 166,922,191 (GRCm38) F123L probably damaging Het
Cul7 T A 17: 46,663,190 (GRCm38) L1467H probably damaging Het
Dcx G C X: 143,923,103 (GRCm38) L231V probably damaging Het
Dnah12 T C 14: 26,792,264 (GRCm38) probably null Het
Dnah2 A T 11: 69,464,930 (GRCm38) M2227K probably damaging Het
Dnajc30 G A 5: 135,064,332 (GRCm38) A28T probably benign Het
Dnm1l T C 16: 16,329,966 (GRCm38) T306A probably benign Het
Enpp3 C A 10: 24,776,771 (GRCm38) E763* probably null Het
Esyt3 T C 9: 99,320,311 (GRCm38) S516G probably benign Het
Exoc3 T C 13: 74,182,316 (GRCm38) Q498R probably damaging Het
Fbn2 T A 18: 58,061,742 (GRCm38) N1449I probably damaging Het
Fgb T C 3: 83,044,980 (GRCm38) D194G probably benign Het
Fgd3 T C 13: 49,263,848 (GRCm38) D713G possibly damaging Het
Foxb1 T A 9: 69,760,101 (GRCm38) Y49F possibly damaging Het
Fpr3 A G 17: 17,971,408 (GRCm38) I314V probably damaging Het
Gfod1 A T 13: 43,303,445 (GRCm38) I18N probably damaging Het
Gm11492 T C 11: 87,567,012 (GRCm38) S71P probably benign Het
Gm5407 T C 16: 49,296,920 (GRCm38) noncoding transcript Het
Gm7534 A G 4: 134,192,675 (GRCm38) probably null Het
Gpr89 A G 3: 96,875,633 (GRCm38) F334L possibly damaging Het
Gucy2d G T 7: 98,443,847 (GRCm38) V144F probably benign Het
H2-Bl T A 17: 36,081,016 (GRCm38) K237M probably damaging Het
H2-M10.5 C A 17: 36,774,768 (GRCm38) P273H probably damaging Het
Hcn2 A G 10: 79,730,943 (GRCm38) M485V probably benign Het
Helz2 G T 2: 181,233,750 (GRCm38) S1650R probably damaging Het
Ifnar2 T C 16: 91,404,170 (GRCm38) V433A probably benign Het
Igsf21 T A 4: 140,107,312 (GRCm38) Y83F probably benign Het
Kcnk18 A G 19: 59,235,058 (GRCm38) I212V possibly damaging Het
Kcns2 T C 15: 34,839,709 (GRCm38) I406T probably damaging Het
Krt42 C T 11: 100,267,249 (GRCm38) V166M possibly damaging Het
Lama3 T C 18: 12,495,279 (GRCm38) M1476T probably benign Het
Lcor A G 19: 41,558,474 (GRCm38) R166G probably benign Het
Mapt C T 11: 104,328,075 (GRCm38) P354L probably damaging Het
Mep1b A T 18: 21,093,229 (GRCm38) I383F probably benign Het
Mpzl1 C A 1: 165,601,805 (GRCm38) C222F probably benign Het
Mug2 T C 6: 122,070,870 (GRCm38) L780P probably damaging Het
Naip2 C T 13: 100,152,157 (GRCm38) probably null Het
Ndufab1 T C 7: 122,096,691 (GRCm38) D41G probably benign Het
Ntn1 A G 11: 68,213,185 (GRCm38) C546R probably damaging Het
Olfr448 T A 6: 42,896,753 (GRCm38) F101I probably damaging Het
Pakap A G 4: 57,892,963 (GRCm38) E880G probably damaging Het
Pde6b A G 5: 108,427,190 (GRCm38) E639G probably benign Het
Phf10 T C 17: 14,956,809 (GRCm38) T83A probably benign Het
Phkb T A 8: 85,901,920 (GRCm38) I186N possibly damaging Het
Pkhd1 A G 1: 20,566,756 (GRCm38) probably null Het
Plxnd1 C A 6: 115,978,017 (GRCm38) A595S possibly damaging Het
Ppara T A 15: 85,801,099 (GRCm38) H416Q probably damaging Het
Prodh T A 16: 18,081,027 (GRCm38) D188V probably damaging Het
Psmd14 A T 2: 61,785,456 (GRCm38) K223M possibly damaging Het
Ptpn5 A G 7: 47,078,868 (GRCm38) M528T possibly damaging Het
Rassf9 G A 10: 102,544,939 (GRCm38) E59K probably benign Het
Rnf2 A T 1: 151,476,185 (GRCm38) L140H probably damaging Het
Scai A G 2: 39,080,081 (GRCm38) F557S probably damaging Het
Sdk2 A G 11: 113,856,726 (GRCm38) S653P possibly damaging Het
Sec24c A G 14: 20,689,111 (GRCm38) D534G probably benign Het
Serinc1 A G 10: 57,519,465 (GRCm38) V375A probably benign Het
Serpinb9f C T 13: 33,325,846 (GRCm38) A7V probably damaging Het
Smco1 T C 16: 32,273,882 (GRCm38) S124P probably damaging Het
Smim23 C A 11: 32,824,441 (GRCm38) C26F possibly damaging Het
Sppl2c T A 11: 104,187,889 (GRCm38) M505K probably benign Het
Sprr1b C A 3: 92,437,468 (GRCm38) V34F possibly damaging Het
Sun1 G A 5: 139,235,732 (GRCm38) probably null Het
Supt16 A G 14: 52,178,135 (GRCm38) L381P possibly damaging Het
Syne2 A G 12: 75,899,246 (GRCm38) D364G possibly damaging Het
Tax1bp1 G T 6: 52,765,952 (GRCm38) V775F probably damaging Het
Tial1 T A 7: 128,444,659 (GRCm38) I231F probably damaging Het
Tiam1 C A 16: 89,798,694 (GRCm38) V1300L probably damaging Het
Tmem132e A G 11: 82,443,417 (GRCm38) T585A probably damaging Het
Tnni3k C T 3: 154,979,199 (GRCm38) A165T probably benign Het
Tomm40 A T 7: 19,710,961 (GRCm38) I165N probably damaging Het
Tomt T C 7: 101,901,247 (GRCm38) E104G probably damaging Het
Topaz1 T C 9: 122,767,013 (GRCm38) S950P possibly damaging Het
Traf3ip2 C G 10: 39,625,940 (GRCm38) P28R probably benign Het
Trim24 C T 6: 37,957,815 (GRCm38) P822S probably damaging Het
Upf3a T G 8: 13,792,108 (GRCm38) Y175D probably damaging Het
Vars2 G A 17: 35,666,922 (GRCm38) P69S probably benign Het
Veph1 T C 3: 66,244,555 (GRCm38) Y151C probably damaging Het
Vmn2r11 T A 5: 109,054,788 (GRCm38) D141V probably benign Het
Vwa5b1 G A 4: 138,592,020 (GRCm38) Q442* probably null Het
Wdr17 T A 8: 54,687,726 (GRCm38) D197V probably damaging Het
Wdr70 G T 15: 7,884,410 (GRCm38) T586N possibly damaging Het
Wfdc18 G A 11: 83,709,928 (GRCm38) G52R probably benign Het
Zc3h6 T C 2: 129,016,620 (GRCm38) I857T probably damaging Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,412,524 (GRCm38) probably benign Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 (GRCm38) probably benign Het
Zfp647 C T 15: 76,911,951 (GRCm38) V170I probably benign Het
Zfp871 T C 17: 32,775,917 (GRCm38) N76D possibly damaging Het
Zwilch A G 9: 64,160,952 (GRCm38) Y194H probably damaging Het
Other mutations in Brdt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Brdt APN 5 107,342,203 (GRCm38) missense probably damaging 1.00
IGL02718:Brdt APN 5 107,350,068 (GRCm38) splice site probably benign
IGL02746:Brdt APN 5 107,370,324 (GRCm38) missense probably benign
IGL02851:Brdt APN 5 107,377,995 (GRCm38) missense possibly damaging 0.47
R0585:Brdt UTSW 5 107,356,882 (GRCm38) critical splice donor site probably null
R0708:Brdt UTSW 5 107,358,900 (GRCm38) nonsense probably null
R1338:Brdt UTSW 5 107,350,188 (GRCm38) missense probably benign 0.02
R1710:Brdt UTSW 5 107,343,584 (GRCm38) missense probably damaging 1.00
R1794:Brdt UTSW 5 107,359,853 (GRCm38) small deletion probably benign
R1861:Brdt UTSW 5 107,359,458 (GRCm38) missense probably benign
R2029:Brdt UTSW 5 107,359,224 (GRCm38) missense probably benign 0.35
R2431:Brdt UTSW 5 107,378,015 (GRCm38) splice site probably null
R3121:Brdt UTSW 5 107,377,145 (GRCm38) missense probably damaging 0.99
R3122:Brdt UTSW 5 107,377,145 (GRCm38) missense probably damaging 0.99
R4258:Brdt UTSW 5 107,359,909 (GRCm38) missense probably damaging 0.97
R4609:Brdt UTSW 5 107,359,936 (GRCm38) missense probably benign 0.00
R5306:Brdt UTSW 5 107,345,144 (GRCm38) missense probably damaging 1.00
R5640:Brdt UTSW 5 107,359,308 (GRCm38) nonsense probably null
R5677:Brdt UTSW 5 107,348,617 (GRCm38) missense possibly damaging 0.85
R5936:Brdt UTSW 5 107,359,395 (GRCm38) missense probably damaging 1.00
R6145:Brdt UTSW 5 107,377,999 (GRCm38) missense possibly damaging 0.67
R6261:Brdt UTSW 5 107,348,503 (GRCm38) missense probably benign 0.04
R6408:Brdt UTSW 5 107,385,492 (GRCm38) missense probably damaging 1.00
R6930:Brdt UTSW 5 107,359,215 (GRCm38) missense probably benign 0.35
R7372:Brdt UTSW 5 107,370,294 (GRCm38) missense possibly damaging 0.49
R7741:Brdt UTSW 5 107,358,886 (GRCm38) missense probably benign 0.00
R7842:Brdt UTSW 5 107,348,588 (GRCm38) missense possibly damaging 0.49
R7869:Brdt UTSW 5 107,370,179 (GRCm38) missense probably benign 0.04
R7887:Brdt UTSW 5 107,359,933 (GRCm38) missense possibly damaging 0.66
R7972:Brdt UTSW 5 107,348,549 (GRCm38) missense possibly damaging 0.53
R8064:Brdt UTSW 5 107,377,996 (GRCm38) nonsense probably null
R8958:Brdt UTSW 5 107,378,011 (GRCm38) missense probably benign
R9199:Brdt UTSW 5 107,350,163 (GRCm38) nonsense probably null
R9346:Brdt UTSW 5 107,377,014 (GRCm38) missense probably damaging 0.99
X0011:Brdt UTSW 5 107,377,092 (GRCm38) missense probably damaging 1.00
X0011:Brdt UTSW 5 107,342,128 (GRCm38) missense probably damaging 0.96
Z1176:Brdt UTSW 5 107,359,898 (GRCm38) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGACTCTGGTTCACATTTCACTAG -3'
(R):5'- ACAAGTTTAAAGGCACAGCG -3'

Sequencing Primer
(F):5'- GATATCCAACAAAAGATAGCGGTTTC -3'
(R):5'- ACACCTGTAGTTCCAGTACTGTGAG -3'
Posted On 2014-07-14