Incidental Mutation 'R1913:Trim24'
ID 214555
Institutional Source Beutler Lab
Gene Symbol Trim24
Ensembl Gene ENSMUSG00000029833
Gene Name tripartite motif-containing 24
Synonyms D430004I05Rik, A130082H20Rik, TIF1alpha, Tif1a
MMRRC Submission 039931-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1913 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 37847746-37943231 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 37934750 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 822 (P822S)
Ref Sequence ENSEMBL: ENSMUSP00000113063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031859] [ENSMUST00000120238] [ENSMUST00000120428]
AlphaFold Q64127
Predicted Effect probably damaging
Transcript: ENSMUST00000031859
AA Change: P856S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031859
Gene: ENSMUSG00000029833
AA Change: P856S

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 2.5e-10 SMART
BBOX 158 205 2e-13 SMART
BBOX 218 259 7e-14 SMART
BBC 266 392 3e-44 SMART
low complexity region 474 491 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
low complexity region 573 598 N/A INTRINSIC
low complexity region 686 709 N/A INTRINSIC
low complexity region 759 774 N/A INTRINSIC
PHD 829 872 2.1e-13 SMART
BROMO 902 1007 2.4e-40 SMART
low complexity region 1025 1033 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120238
AA Change: P786S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114001
Gene: ENSMUSG00000029833
AA Change: P786S

DomainStartEndE-ValueType
BBOX 88 135 2e-13 SMART
BBOX 148 189 6.8e-14 SMART
BBC 196 322 3e-44 SMART
low complexity region 404 421 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 616 639 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
PHD 759 802 2e-13 SMART
BROMO 832 937 2.4e-40 SMART
low complexity region 955 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120428
AA Change: P822S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113063
Gene: ENSMUSG00000029833
AA Change: P822S

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 5.22e-8 SMART
BBOX 158 205 6.27e-11 SMART
BBOX 218 259 2.22e-11 SMART
BBC 266 392 5.86e-42 SMART
low complexity region 539 564 N/A INTRINSIC
low complexity region 652 675 N/A INTRINSIC
low complexity region 725 740 N/A INTRINSIC
PHD 795 838 3.15e-11 SMART
BROMO 868 973 3.95e-38 SMART
low complexity region 991 999 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135387
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which are typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. This protein, which also contains a PHD/TTC finger and bromodomain important for regulating nuclear receptors and binding chromatin, has important roles in differentiation, development, and tissue homeostasis. This protein has been reported to regulate the activity of the tumor suppressor p53 and of the retinoic acid receptor. A translocation event between this gene and Braf transforming gene, which results in the fusion protein T18, has been reported in hepatocellular carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased hepatocyte ploidy and uncontrolled hepatocellular proliferation; most adult mice develop malignant hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,140,463 (GRCm39) I1588F probably benign Het
Abcc2 A T 19: 43,795,683 (GRCm39) T480S probably benign Het
Acnat1 A G 4: 49,447,498 (GRCm39) I361T probably damaging Het
Adamts10 A T 17: 33,768,529 (GRCm39) H869L probably benign Het
Agpat5 T C 8: 18,929,629 (GRCm39) C253R probably benign Het
Agtrap T A 4: 148,168,434 (GRCm39) H15L probably damaging Het
Ahnak T A 19: 8,985,286 (GRCm39) V2190E probably damaging Het
Alx4 A G 2: 93,505,732 (GRCm39) E278G probably damaging Het
Amz2 T C 11: 109,319,697 (GRCm39) S28P probably damaging Het
Atr T A 9: 95,748,786 (GRCm39) Y444N probably benign Het
Brdt T C 5: 107,496,479 (GRCm39) I197T probably benign Het
Ccser1 G T 6: 62,356,878 (GRCm39) S772I probably damaging Het
Cdh16 T C 8: 105,343,100 (GRCm39) H657R probably benign Het
Ceacam5 A T 7: 17,493,502 (GRCm39) K842* probably null Het
Cep120 G A 18: 53,856,358 (GRCm39) T353I probably benign Het
Chrnb1 T C 11: 69,684,410 (GRCm39) N164S possibly damaging Het
Cse1l T C 2: 166,764,111 (GRCm39) F123L probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dcx G C X: 142,706,099 (GRCm39) L231V probably damaging Het
Dnah12 T C 14: 26,514,221 (GRCm39) probably null Het
Dnah2 A T 11: 69,355,756 (GRCm39) M2227K probably damaging Het
Dnajc30 G A 5: 135,093,186 (GRCm39) A28T probably benign Het
Dnm1l T C 16: 16,147,830 (GRCm39) T306A probably benign Het
Elapor2 T G 5: 9,316,275 (GRCm39) L2R probably damaging Het
Enpp3 C A 10: 24,652,669 (GRCm39) E763* probably null Het
Esyt3 T C 9: 99,202,364 (GRCm39) S516G probably benign Het
Exoc3 T C 13: 74,330,435 (GRCm39) Q498R probably damaging Het
Fbn2 T A 18: 58,194,814 (GRCm39) N1449I probably damaging Het
Fgb T C 3: 82,952,287 (GRCm39) D194G probably benign Het
Fgd3 T C 13: 49,417,324 (GRCm39) D713G possibly damaging Het
Foxb1 T A 9: 69,667,383 (GRCm39) Y49F possibly damaging Het
Fpr3 A G 17: 18,191,670 (GRCm39) I314V probably damaging Het
Gfod1 A T 13: 43,456,921 (GRCm39) I18N probably damaging Het
Gm5407 T C 16: 49,117,283 (GRCm39) noncoding transcript Het
Gpr89 A G 3: 96,782,949 (GRCm39) F334L possibly damaging Het
Gucy2d G T 7: 98,093,054 (GRCm39) V144F probably benign Het
H2-M10.5 C A 17: 37,085,660 (GRCm39) P273H probably damaging Het
H2-T13 T A 17: 36,391,908 (GRCm39) K237M probably damaging Het
Hcn2 A G 10: 79,566,777 (GRCm39) M485V probably benign Het
Helz2 G T 2: 180,875,543 (GRCm39) S1650R probably damaging Het
Ifnar2 T C 16: 91,201,058 (GRCm39) V433A probably benign Het
Igsf21 T A 4: 139,834,623 (GRCm39) Y83F probably benign Het
Kcnk18 A G 19: 59,223,490 (GRCm39) I212V possibly damaging Het
Kcns2 T C 15: 34,839,855 (GRCm39) I406T probably damaging Het
Krt42 C T 11: 100,158,075 (GRCm39) V166M possibly damaging Het
Lama3 T C 18: 12,628,336 (GRCm39) M1476T probably benign Het
Lcor A G 19: 41,546,913 (GRCm39) R166G probably benign Het
Mapt C T 11: 104,218,901 (GRCm39) P354L probably damaging Het
Mep1b A T 18: 21,226,286 (GRCm39) I383F probably benign Het
Mpzl1 C A 1: 165,429,374 (GRCm39) C222F probably benign Het
Mug2 T C 6: 122,047,829 (GRCm39) L780P probably damaging Het
Naip2 C T 13: 100,288,665 (GRCm39) probably null Het
Ndufab1 T C 7: 121,695,914 (GRCm39) D41G probably benign Het
Ntn1 A G 11: 68,104,011 (GRCm39) C546R probably damaging Het
Or2a5 T A 6: 42,873,687 (GRCm39) F101I probably damaging Het
Pakap A G 4: 57,892,963 (GRCm39) E880G probably damaging Het
Pde6b A G 5: 108,575,056 (GRCm39) E639G probably benign Het
Phf10 T C 17: 15,177,071 (GRCm39) T83A probably benign Het
Phkb T A 8: 86,628,549 (GRCm39) I186N possibly damaging Het
Pkhd1 A G 1: 20,636,980 (GRCm39) probably null Het
Plxnd1 C A 6: 115,954,978 (GRCm39) A595S possibly damaging Het
Ppara T A 15: 85,685,300 (GRCm39) H416Q probably damaging Het
Prodh T A 16: 17,898,891 (GRCm39) D188V probably damaging Het
Psmd14 A T 2: 61,615,800 (GRCm39) K223M possibly damaging Het
Ptpn5 A G 7: 46,728,616 (GRCm39) M528T possibly damaging Het
Rassf9 G A 10: 102,380,800 (GRCm39) E59K probably benign Het
Rnf2 A T 1: 151,351,936 (GRCm39) L140H probably damaging Het
Scai A G 2: 38,970,093 (GRCm39) F557S probably damaging Het
Sdk2 A G 11: 113,747,552 (GRCm39) S653P possibly damaging Het
Sec24c A G 14: 20,739,179 (GRCm39) D534G probably benign Het
Semp2l2a T A 8: 13,887,143 (GRCm39) Q316L probably benign Het
Septin4 T C 11: 87,457,838 (GRCm39) S71P probably benign Het
Serinc1 A G 10: 57,395,561 (GRCm39) V375A probably benign Het
Serpinb9f C T 13: 33,509,829 (GRCm39) A7V probably damaging Het
Smco1 T C 16: 32,092,700 (GRCm39) S124P probably damaging Het
Smim23 C A 11: 32,774,441 (GRCm39) C26F possibly damaging Het
Sppl2c T A 11: 104,078,715 (GRCm39) M505K probably benign Het
Sprr1b C A 3: 92,344,775 (GRCm39) V34F possibly damaging Het
Sun1 G A 5: 139,221,487 (GRCm39) probably null Het
Supt16 A G 14: 52,415,592 (GRCm39) L381P possibly damaging Het
Syne2 A G 12: 75,946,020 (GRCm39) D364G possibly damaging Het
Tax1bp1 G T 6: 52,742,937 (GRCm39) V775F probably damaging Het
Tial1 T A 7: 128,046,383 (GRCm39) I231F probably damaging Het
Tiam1 C A 16: 89,595,582 (GRCm39) V1300L probably damaging Het
Tmem132e A G 11: 82,334,243 (GRCm39) T585A probably damaging Het
Tnni3k C T 3: 154,684,836 (GRCm39) A165T probably benign Het
Tomm40 A T 7: 19,444,886 (GRCm39) I165N probably damaging Het
Tomt T C 7: 101,550,454 (GRCm39) E104G probably damaging Het
Topaz1 T C 9: 122,596,078 (GRCm39) S950P possibly damaging Het
Traf3ip2 C G 10: 39,501,936 (GRCm39) P28R probably benign Het
Upf3a T G 8: 13,842,108 (GRCm39) Y175D probably damaging Het
Vars2 G A 17: 35,977,814 (GRCm39) P69S probably benign Het
Veph1 T C 3: 66,151,976 (GRCm39) Y151C probably damaging Het
Vmn2r11 T A 5: 109,202,654 (GRCm39) D141V probably benign Het
Vwa5b1 G A 4: 138,319,331 (GRCm39) Q442* probably null Het
Wdr17 T A 8: 55,140,761 (GRCm39) D197V probably damaging Het
Wdr70 G T 15: 7,913,891 (GRCm39) T586N possibly damaging Het
Wfdc18 G A 11: 83,600,754 (GRCm39) G52R probably benign Het
Zc3h6 T C 2: 128,858,540 (GRCm39) I857T probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,723,440 (GRCm39) probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,723,450 (GRCm39) probably benign Het
Zfp647 C T 15: 76,796,151 (GRCm39) V170I probably benign Het
Zfp871 T C 17: 32,994,891 (GRCm39) N76D possibly damaging Het
Zpld2 A G 4: 133,919,986 (GRCm39) probably null Het
Zwilch A G 9: 64,068,234 (GRCm39) Y194H probably damaging Het
Other mutations in Trim24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Trim24 APN 6 37,880,583 (GRCm39) missense possibly damaging 0.76
IGL01307:Trim24 APN 6 37,942,570 (GRCm39) missense possibly damaging 0.81
IGL01790:Trim24 APN 6 37,922,548 (GRCm39) missense probably benign
IGL02525:Trim24 APN 6 37,922,653 (GRCm39) missense probably damaging 0.99
IGL02557:Trim24 APN 6 37,942,434 (GRCm39) critical splice acceptor site probably null
IGL02671:Trim24 APN 6 37,937,719 (GRCm39) missense probably damaging 1.00
IGL02795:Trim24 APN 6 37,896,324 (GRCm39) missense probably damaging 1.00
IGL02877:Trim24 APN 6 37,942,581 (GRCm39) missense probably damaging 1.00
IGL02889:Trim24 APN 6 37,934,696 (GRCm39) missense probably benign 0.02
IGL02930:Trim24 APN 6 37,928,380 (GRCm39) splice site probably benign
IGL03076:Trim24 APN 6 37,942,567 (GRCm39) missense probably damaging 0.98
accomodating UTSW 6 37,896,332 (GRCm39) missense probably damaging 1.00
apprehensive UTSW 6 37,934,435 (GRCm39) splice site probably benign
Flexible UTSW 6 37,880,588 (GRCm39) critical splice donor site probably benign
Lithe UTSW 6 37,935,504 (GRCm39) missense probably damaging 1.00
Nervous UTSW 6 37,934,664 (GRCm39) missense probably damaging 1.00
perturbed UTSW 6 37,896,427 (GRCm39) critical splice donor site probably null
pliant UTSW 6 37,896,426 (GRCm39) critical splice donor site probably null
qualmish UTSW 6 37,880,587 (GRCm39) critical splice donor site probably null
Queasy UTSW 6 37,885,240 (GRCm39) missense probably damaging 0.99
squeamish UTSW 6 37,892,137 (GRCm39) nonsense probably null
uneasy UTSW 6 37,933,412 (GRCm39) critical splice donor site probably null
PIT4651001:Trim24 UTSW 6 37,877,667 (GRCm39) critical splice donor site probably null
R0037:Trim24 UTSW 6 37,934,484 (GRCm39) missense probably damaging 1.00
R0037:Trim24 UTSW 6 37,934,484 (GRCm39) missense probably damaging 1.00
R0183:Trim24 UTSW 6 37,920,415 (GRCm39) missense possibly damaging 0.90
R0471:Trim24 UTSW 6 37,892,130 (GRCm39) missense possibly damaging 0.94
R0485:Trim24 UTSW 6 37,934,001 (GRCm39) missense probably damaging 1.00
R0606:Trim24 UTSW 6 37,848,169 (GRCm39) missense probably benign
R0609:Trim24 UTSW 6 37,934,718 (GRCm39) missense probably damaging 1.00
R0637:Trim24 UTSW 6 37,935,494 (GRCm39) splice site probably null
R0734:Trim24 UTSW 6 37,896,400 (GRCm39) missense possibly damaging 0.86
R0855:Trim24 UTSW 6 37,892,137 (GRCm39) nonsense probably null
R1131:Trim24 UTSW 6 37,934,717 (GRCm39) missense probably damaging 1.00
R1141:Trim24 UTSW 6 37,892,228 (GRCm39) missense probably damaging 1.00
R1159:Trim24 UTSW 6 37,933,412 (GRCm39) critical splice donor site probably null
R1460:Trim24 UTSW 6 37,941,761 (GRCm39) missense probably damaging 1.00
R1672:Trim24 UTSW 6 37,892,214 (GRCm39) missense probably damaging 1.00
R1868:Trim24 UTSW 6 37,928,447 (GRCm39) missense probably damaging 0.99
R1888:Trim24 UTSW 6 37,934,013 (GRCm39) missense probably damaging 0.99
R1888:Trim24 UTSW 6 37,934,013 (GRCm39) missense probably damaging 0.99
R1894:Trim24 UTSW 6 37,934,013 (GRCm39) missense probably damaging 0.99
R2254:Trim24 UTSW 6 37,935,612 (GRCm39) missense probably benign
R2511:Trim24 UTSW 6 37,880,587 (GRCm39) critical splice donor site probably null
R2849:Trim24 UTSW 6 37,933,388 (GRCm39) missense probably damaging 0.99
R3878:Trim24 UTSW 6 37,941,708 (GRCm39) missense probably benign 0.14
R4084:Trim24 UTSW 6 37,892,192 (GRCm39) missense probably damaging 1.00
R4235:Trim24 UTSW 6 37,941,675 (GRCm39) missense probably damaging 1.00
R4292:Trim24 UTSW 6 37,877,627 (GRCm39) missense possibly damaging 0.91
R4633:Trim24 UTSW 6 37,933,371 (GRCm39) missense probably damaging 0.98
R4651:Trim24 UTSW 6 37,934,774 (GRCm39) critical splice donor site probably null
R4652:Trim24 UTSW 6 37,934,774 (GRCm39) critical splice donor site probably null
R4686:Trim24 UTSW 6 37,885,240 (GRCm39) missense probably damaging 0.99
R5000:Trim24 UTSW 6 37,935,547 (GRCm39) missense probably benign 0.01
R5213:Trim24 UTSW 6 37,934,010 (GRCm39) missense probably damaging 0.99
R5258:Trim24 UTSW 6 37,896,335 (GRCm39) missense probably benign 0.37
R5292:Trim24 UTSW 6 37,880,539 (GRCm39) missense probably benign 0.23
R5395:Trim24 UTSW 6 37,934,679 (GRCm39) missense probably damaging 1.00
R5547:Trim24 UTSW 6 37,942,485 (GRCm39) missense probably damaging 1.00
R5666:Trim24 UTSW 6 37,942,536 (GRCm39) missense probably benign 0.19
R5670:Trim24 UTSW 6 37,942,536 (GRCm39) missense probably benign 0.19
R5849:Trim24 UTSW 6 37,934,664 (GRCm39) missense probably damaging 1.00
R5927:Trim24 UTSW 6 37,935,504 (GRCm39) missense probably damaging 1.00
R5932:Trim24 UTSW 6 37,934,010 (GRCm39) missense probably damaging 0.99
R6286:Trim24 UTSW 6 37,896,426 (GRCm39) critical splice donor site probably null
R6374:Trim24 UTSW 6 37,930,484 (GRCm39) missense probably benign 0.12
R6449:Trim24 UTSW 6 37,880,587 (GRCm39) critical splice donor site probably null
R6723:Trim24 UTSW 6 37,928,403 (GRCm39) missense probably benign 0.00
R6731:Trim24 UTSW 6 37,920,420 (GRCm39) missense probably damaging 0.99
R6975:Trim24 UTSW 6 37,896,427 (GRCm39) critical splice donor site probably null
R7000:Trim24 UTSW 6 37,935,613 (GRCm39) missense probably benign 0.24
R7067:Trim24 UTSW 6 37,934,775 (GRCm39) splice site probably null
R7126:Trim24 UTSW 6 37,896,392 (GRCm39) missense probably damaging 1.00
R7162:Trim24 UTSW 6 37,942,456 (GRCm39) missense possibly damaging 0.68
R7486:Trim24 UTSW 6 37,934,774 (GRCm39) critical splice donor site probably null
R7779:Trim24 UTSW 6 37,896,333 (GRCm39) missense probably damaging 0.99
R7779:Trim24 UTSW 6 37,896,332 (GRCm39) missense probably damaging 1.00
R8070:Trim24 UTSW 6 37,934,661 (GRCm39) missense probably damaging 0.99
R8096:Trim24 UTSW 6 37,935,592 (GRCm39) missense probably benign 0.03
R8184:Trim24 UTSW 6 37,848,242 (GRCm39) missense probably damaging 1.00
R8323:Trim24 UTSW 6 37,892,233 (GRCm39) critical splice donor site probably null
R8476:Trim24 UTSW 6 37,922,578 (GRCm39) nonsense probably null
R8705:Trim24 UTSW 6 37,880,588 (GRCm39) critical splice donor site probably benign
R8770:Trim24 UTSW 6 37,934,435 (GRCm39) splice site probably benign
R9021:Trim24 UTSW 6 37,933,949 (GRCm39) missense probably damaging 0.99
R9166:Trim24 UTSW 6 37,934,074 (GRCm39) missense probably damaging 1.00
R9212:Trim24 UTSW 6 37,896,335 (GRCm39) missense probably benign 0.37
R9350:Trim24 UTSW 6 37,892,208 (GRCm39) missense probably damaging 1.00
R9678:Trim24 UTSW 6 37,942,449 (GRCm39) missense probably damaging 1.00
RF007:Trim24 UTSW 6 37,930,471 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAGCCTGGACTCCATCAAGAA -3'
(R):5'- GCCATGTCATTCCTTTCCAGTTG -3'

Sequencing Primer
(F):5'- GCCTGGACTCCATCAAGAAAATTC -3'
(R):5'- ATGTCATTCCTTTCCAGTTGTACC -3'
Posted On 2014-07-14