Incidental Mutation 'R1913:Tomt'
ID 214565
Institutional Source Beutler Lab
Gene Symbol Tomt
Ensembl Gene ENSMUSG00000078630
Gene Name transmembrane O-methyltransferase
Synonyms Comt2, F930017I19Rik
MMRRC Submission 039931-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.209) question?
Stock # R1913 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 101549010-101555572 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101550454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 104 (E104G)
Ref Sequence ENSEMBL: ENSMUSP00000102583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033131] [ENSMUST00000035395] [ENSMUST00000098237] [ENSMUST00000106969] [ENSMUST00000106970] [ENSMUST00000209334] [ENSMUST00000143835] [ENSMUST00000106978] [ENSMUST00000193465] [ENSMUST00000178851] [ENSMUST00000106973] [ENSMUST00000144207] [ENSMUST00000210984]
AlphaFold A1Y9I9
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032884
Predicted Effect probably benign
Transcript: ENSMUST00000033131
SMART Domains Protein: ENSMUSP00000033131
Gene: ENSMUSG00000030842

DomainStartEndE-ValueType
LAMTOR 15 90 1.48e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035395
SMART Domains Protein: ENSMUSP00000040286
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 21 115 9.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098237
SMART Domains Protein: ENSMUSP00000095839
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 13 104 6.5e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106969
AA Change: E104G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102582
Gene: ENSMUSG00000078630
AA Change: E104G

DomainStartEndE-ValueType
Pfam:Methyltransf_3 64 226 1.2e-16 PFAM
Pfam:Methyltransf_24 103 212 5.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106970
AA Change: E104G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102583
Gene: ENSMUSG00000078630
AA Change: E104G

DomainStartEndE-ValueType
Pfam:Methyltransf_3 65 223 9.1e-19 PFAM
Pfam:Methyltransf_24 103 212 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150018
Predicted Effect probably benign
Transcript: ENSMUST00000209334
Predicted Effect probably benign
Transcript: ENSMUST00000143835
SMART Domains Protein: ENSMUSP00000120373
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 6.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106978
SMART Domains Protein: ENSMUSP00000102591
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193465
SMART Domains Protein: ENSMUSP00000141774
Gene: ENSMUSG00000030842

DomainStartEndE-ValueType
LAMTOR 15 90 1.1e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178851
SMART Domains Protein: ENSMUSP00000136164
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106973
SMART Domains Protein: ENSMUSP00000102586
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 1 95 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144207
SMART Domains Protein: ENSMUSP00000114771
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210984
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene includes two transcript forms. The short form has one open reading frame (ORF), which encodes the leucine-rich repeats (LRR)-containing protein of unknown function. This protein is called LRTOMT1 or LRRC51. The long form has two alternative ORFs; the upstream ORF has the same translation start codon as used in the short form and the resulting transcript is a candidate for nonsense-mediated decay, and the downstream ORF encodes a different protein, which is a transmembrane catechol-O-methyltransferase and is called LRTOMT2, TOMT or COMT2. The COMT2 is essential for auditory and vestibular function. Defects in the COMT2 can cause nonsyndromic deafness. Alternatively spliced transcript variants from each transcript form have been found for this gene. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a mutation of this gene exhibit marked hyperactivity, bidirectional circling and head-tossing. These behaviors are suppressed during sleep and nursing. Homozygous mutant males exhibit heightened male:male aggression. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,140,463 (GRCm39) I1588F probably benign Het
Abcc2 A T 19: 43,795,683 (GRCm39) T480S probably benign Het
Acnat1 A G 4: 49,447,498 (GRCm39) I361T probably damaging Het
Adamts10 A T 17: 33,768,529 (GRCm39) H869L probably benign Het
Agpat5 T C 8: 18,929,629 (GRCm39) C253R probably benign Het
Agtrap T A 4: 148,168,434 (GRCm39) H15L probably damaging Het
Ahnak T A 19: 8,985,286 (GRCm39) V2190E probably damaging Het
Alx4 A G 2: 93,505,732 (GRCm39) E278G probably damaging Het
Amz2 T C 11: 109,319,697 (GRCm39) S28P probably damaging Het
Atr T A 9: 95,748,786 (GRCm39) Y444N probably benign Het
Brdt T C 5: 107,496,479 (GRCm39) I197T probably benign Het
Ccser1 G T 6: 62,356,878 (GRCm39) S772I probably damaging Het
Cdh16 T C 8: 105,343,100 (GRCm39) H657R probably benign Het
Ceacam5 A T 7: 17,493,502 (GRCm39) K842* probably null Het
Cep120 G A 18: 53,856,358 (GRCm39) T353I probably benign Het
Chrnb1 T C 11: 69,684,410 (GRCm39) N164S possibly damaging Het
Cse1l T C 2: 166,764,111 (GRCm39) F123L probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dcx G C X: 142,706,099 (GRCm39) L231V probably damaging Het
Dnah12 T C 14: 26,514,221 (GRCm39) probably null Het
Dnah2 A T 11: 69,355,756 (GRCm39) M2227K probably damaging Het
Dnajc30 G A 5: 135,093,186 (GRCm39) A28T probably benign Het
Dnm1l T C 16: 16,147,830 (GRCm39) T306A probably benign Het
Elapor2 T G 5: 9,316,275 (GRCm39) L2R probably damaging Het
Enpp3 C A 10: 24,652,669 (GRCm39) E763* probably null Het
Esyt3 T C 9: 99,202,364 (GRCm39) S516G probably benign Het
Exoc3 T C 13: 74,330,435 (GRCm39) Q498R probably damaging Het
Fbn2 T A 18: 58,194,814 (GRCm39) N1449I probably damaging Het
Fgb T C 3: 82,952,287 (GRCm39) D194G probably benign Het
Fgd3 T C 13: 49,417,324 (GRCm39) D713G possibly damaging Het
Foxb1 T A 9: 69,667,383 (GRCm39) Y49F possibly damaging Het
Fpr3 A G 17: 18,191,670 (GRCm39) I314V probably damaging Het
Gfod1 A T 13: 43,456,921 (GRCm39) I18N probably damaging Het
Gm5407 T C 16: 49,117,283 (GRCm39) noncoding transcript Het
Gpr89 A G 3: 96,782,949 (GRCm39) F334L possibly damaging Het
Gucy2d G T 7: 98,093,054 (GRCm39) V144F probably benign Het
H2-M10.5 C A 17: 37,085,660 (GRCm39) P273H probably damaging Het
H2-T13 T A 17: 36,391,908 (GRCm39) K237M probably damaging Het
Hcn2 A G 10: 79,566,777 (GRCm39) M485V probably benign Het
Helz2 G T 2: 180,875,543 (GRCm39) S1650R probably damaging Het
Ifnar2 T C 16: 91,201,058 (GRCm39) V433A probably benign Het
Igsf21 T A 4: 139,834,623 (GRCm39) Y83F probably benign Het
Kcnk18 A G 19: 59,223,490 (GRCm39) I212V possibly damaging Het
Kcns2 T C 15: 34,839,855 (GRCm39) I406T probably damaging Het
Krt42 C T 11: 100,158,075 (GRCm39) V166M possibly damaging Het
Lama3 T C 18: 12,628,336 (GRCm39) M1476T probably benign Het
Lcor A G 19: 41,546,913 (GRCm39) R166G probably benign Het
Mapt C T 11: 104,218,901 (GRCm39) P354L probably damaging Het
Mep1b A T 18: 21,226,286 (GRCm39) I383F probably benign Het
Mpzl1 C A 1: 165,429,374 (GRCm39) C222F probably benign Het
Mug2 T C 6: 122,047,829 (GRCm39) L780P probably damaging Het
Naip2 C T 13: 100,288,665 (GRCm39) probably null Het
Ndufab1 T C 7: 121,695,914 (GRCm39) D41G probably benign Het
Ntn1 A G 11: 68,104,011 (GRCm39) C546R probably damaging Het
Or2a5 T A 6: 42,873,687 (GRCm39) F101I probably damaging Het
Pakap A G 4: 57,892,963 (GRCm39) E880G probably damaging Het
Pde6b A G 5: 108,575,056 (GRCm39) E639G probably benign Het
Phf10 T C 17: 15,177,071 (GRCm39) T83A probably benign Het
Phkb T A 8: 86,628,549 (GRCm39) I186N possibly damaging Het
Pkhd1 A G 1: 20,636,980 (GRCm39) probably null Het
Plxnd1 C A 6: 115,954,978 (GRCm39) A595S possibly damaging Het
Ppara T A 15: 85,685,300 (GRCm39) H416Q probably damaging Het
Prodh T A 16: 17,898,891 (GRCm39) D188V probably damaging Het
Psmd14 A T 2: 61,615,800 (GRCm39) K223M possibly damaging Het
Ptpn5 A G 7: 46,728,616 (GRCm39) M528T possibly damaging Het
Rassf9 G A 10: 102,380,800 (GRCm39) E59K probably benign Het
Rnf2 A T 1: 151,351,936 (GRCm39) L140H probably damaging Het
Scai A G 2: 38,970,093 (GRCm39) F557S probably damaging Het
Sdk2 A G 11: 113,747,552 (GRCm39) S653P possibly damaging Het
Sec24c A G 14: 20,739,179 (GRCm39) D534G probably benign Het
Semp2l2a T A 8: 13,887,143 (GRCm39) Q316L probably benign Het
Septin4 T C 11: 87,457,838 (GRCm39) S71P probably benign Het
Serinc1 A G 10: 57,395,561 (GRCm39) V375A probably benign Het
Serpinb9f C T 13: 33,509,829 (GRCm39) A7V probably damaging Het
Smco1 T C 16: 32,092,700 (GRCm39) S124P probably damaging Het
Smim23 C A 11: 32,774,441 (GRCm39) C26F possibly damaging Het
Sppl2c T A 11: 104,078,715 (GRCm39) M505K probably benign Het
Sprr1b C A 3: 92,344,775 (GRCm39) V34F possibly damaging Het
Sun1 G A 5: 139,221,487 (GRCm39) probably null Het
Supt16 A G 14: 52,415,592 (GRCm39) L381P possibly damaging Het
Syne2 A G 12: 75,946,020 (GRCm39) D364G possibly damaging Het
Tax1bp1 G T 6: 52,742,937 (GRCm39) V775F probably damaging Het
Tial1 T A 7: 128,046,383 (GRCm39) I231F probably damaging Het
Tiam1 C A 16: 89,595,582 (GRCm39) V1300L probably damaging Het
Tmem132e A G 11: 82,334,243 (GRCm39) T585A probably damaging Het
Tnni3k C T 3: 154,684,836 (GRCm39) A165T probably benign Het
Tomm40 A T 7: 19,444,886 (GRCm39) I165N probably damaging Het
Topaz1 T C 9: 122,596,078 (GRCm39) S950P possibly damaging Het
Traf3ip2 C G 10: 39,501,936 (GRCm39) P28R probably benign Het
Trim24 C T 6: 37,934,750 (GRCm39) P822S probably damaging Het
Upf3a T G 8: 13,842,108 (GRCm39) Y175D probably damaging Het
Vars2 G A 17: 35,977,814 (GRCm39) P69S probably benign Het
Veph1 T C 3: 66,151,976 (GRCm39) Y151C probably damaging Het
Vmn2r11 T A 5: 109,202,654 (GRCm39) D141V probably benign Het
Vwa5b1 G A 4: 138,319,331 (GRCm39) Q442* probably null Het
Wdr17 T A 8: 55,140,761 (GRCm39) D197V probably damaging Het
Wdr70 G T 15: 7,913,891 (GRCm39) T586N possibly damaging Het
Wfdc18 G A 11: 83,600,754 (GRCm39) G52R probably benign Het
Zc3h6 T C 2: 128,858,540 (GRCm39) I857T probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,723,440 (GRCm39) probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,723,450 (GRCm39) probably benign Het
Zfp647 C T 15: 76,796,151 (GRCm39) V170I probably benign Het
Zfp871 T C 17: 32,994,891 (GRCm39) N76D possibly damaging Het
Zpld2 A G 4: 133,919,986 (GRCm39) probably null Het
Zwilch A G 9: 64,068,234 (GRCm39) Y194H probably damaging Het
Other mutations in Tomt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Tomt APN 7 101,551,393 (GRCm39) missense probably benign 0.00
add UTSW 7 101,551,336 (GRCm39) missense probably damaging 1.00
R5737:Tomt UTSW 7 101,549,524 (GRCm39) missense probably benign
R6527:Tomt UTSW 7 101,549,599 (GRCm39) missense probably damaging 1.00
R7414:Tomt UTSW 7 101,549,715 (GRCm39) missense probably damaging 1.00
R7978:Tomt UTSW 7 101,549,554 (GRCm39) missense probably damaging 0.99
R8930:Tomt UTSW 7 101,550,350 (GRCm39) missense probably damaging 1.00
R8932:Tomt UTSW 7 101,550,350 (GRCm39) missense probably damaging 1.00
R9302:Tomt UTSW 7 101,549,826 (GRCm39) missense probably damaging 1.00
R9780:Tomt UTSW 7 101,549,536 (GRCm39) missense probably benign 0.00
X0018:Tomt UTSW 7 101,549,778 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTCCTGGGATAGCTGAAGAGATC -3'
(R):5'- AAGGTAGGGTGGATATTTCGCC -3'

Sequencing Primer
(F):5'- ATCAGCGTTGGGGCGATAG -3'
(R):5'- CTAAACTGAGACTGGAAGGCTTCTC -3'
Posted On 2014-07-14