Incidental Mutation 'R1913:Tial1'
ID 214568
Institutional Source Beutler Lab
Gene Symbol Tial1
Ensembl Gene ENSMUSG00000030846
Gene Name Tia1 cytotoxic granule-associated RNA binding protein-like 1
Synonyms TIAR, mTIAR, 5330433G13Rik
MMRRC Submission 039931-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.817) question?
Stock # R1913 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 128041501-128063441 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 128046383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 231 (I231F)
Ref Sequence ENSEMBL: ENSMUSP00000126458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033135] [ENSMUST00000106226] [ENSMUST00000106228] [ENSMUST00000123666] [ENSMUST00000133444] [ENSMUST00000165023] [ENSMUST00000141126] [ENSMUST00000205278] [ENSMUST00000205835]
AlphaFold P70318
Predicted Effect probably damaging
Transcript: ENSMUST00000033135
AA Change: I231F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033135
Gene: ENSMUSG00000030846
AA Change: I231F

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106226
AA Change: I248F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101833
Gene: ENSMUSG00000030846
AA Change: I248F

DomainStartEndE-ValueType
RRM 10 98 7.41e-18 SMART
RRM 115 188 2.76e-26 SMART
RRM 223 290 1.19e-16 SMART
low complexity region 360 383 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106228
AA Change: I192F
SMART Domains Protein: ENSMUSP00000101835
Gene: ENSMUSG00000030846
AA Change: I192F

DomainStartEndE-ValueType
Pfam:RRM_1 11 50 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123666
SMART Domains Protein: ENSMUSP00000116921
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
Pfam:RRM_1 99 132 1.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133089
Predicted Effect probably damaging
Transcript: ENSMUST00000133444
AA Change: I45F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136782
Predicted Effect probably damaging
Transcript: ENSMUST00000165023
AA Change: I231F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126458
Gene: ENSMUSG00000030846
AA Change: I231F

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141126
AA Change: I100F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152328
Predicted Effect probably benign
Transcript: ENSMUST00000205278
Predicted Effect probably benign
Transcript: ENSMUST00000205835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141079
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RNA-binding proteins, has three RNA recognition motifs (RRMs), and binds adenine and uridine-rich elements in mRNA and pre-mRNAs of a wide range of genes. It regulates various activities including translational control, splicing and apoptosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The different isoforms have been show to function differently with respect to post-transcriptional silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit partial embryonic lethality and reduced postnatal survival, reduced embryonic and postnatal body weight, and male and female sterility. Infertility is owed to a substantial decrease in the survival of primordial germ cells atthe genital ridge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,140,463 (GRCm39) I1588F probably benign Het
Abcc2 A T 19: 43,795,683 (GRCm39) T480S probably benign Het
Acnat1 A G 4: 49,447,498 (GRCm39) I361T probably damaging Het
Adamts10 A T 17: 33,768,529 (GRCm39) H869L probably benign Het
Agpat5 T C 8: 18,929,629 (GRCm39) C253R probably benign Het
Agtrap T A 4: 148,168,434 (GRCm39) H15L probably damaging Het
Ahnak T A 19: 8,985,286 (GRCm39) V2190E probably damaging Het
Alx4 A G 2: 93,505,732 (GRCm39) E278G probably damaging Het
Amz2 T C 11: 109,319,697 (GRCm39) S28P probably damaging Het
Atr T A 9: 95,748,786 (GRCm39) Y444N probably benign Het
Brdt T C 5: 107,496,479 (GRCm39) I197T probably benign Het
Ccser1 G T 6: 62,356,878 (GRCm39) S772I probably damaging Het
Cdh16 T C 8: 105,343,100 (GRCm39) H657R probably benign Het
Ceacam5 A T 7: 17,493,502 (GRCm39) K842* probably null Het
Cep120 G A 18: 53,856,358 (GRCm39) T353I probably benign Het
Chrnb1 T C 11: 69,684,410 (GRCm39) N164S possibly damaging Het
Cse1l T C 2: 166,764,111 (GRCm39) F123L probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dcx G C X: 142,706,099 (GRCm39) L231V probably damaging Het
Dnah12 T C 14: 26,514,221 (GRCm39) probably null Het
Dnah2 A T 11: 69,355,756 (GRCm39) M2227K probably damaging Het
Dnajc30 G A 5: 135,093,186 (GRCm39) A28T probably benign Het
Dnm1l T C 16: 16,147,830 (GRCm39) T306A probably benign Het
Elapor2 T G 5: 9,316,275 (GRCm39) L2R probably damaging Het
Enpp3 C A 10: 24,652,669 (GRCm39) E763* probably null Het
Esyt3 T C 9: 99,202,364 (GRCm39) S516G probably benign Het
Exoc3 T C 13: 74,330,435 (GRCm39) Q498R probably damaging Het
Fbn2 T A 18: 58,194,814 (GRCm39) N1449I probably damaging Het
Fgb T C 3: 82,952,287 (GRCm39) D194G probably benign Het
Fgd3 T C 13: 49,417,324 (GRCm39) D713G possibly damaging Het
Foxb1 T A 9: 69,667,383 (GRCm39) Y49F possibly damaging Het
Fpr3 A G 17: 18,191,670 (GRCm39) I314V probably damaging Het
Gfod1 A T 13: 43,456,921 (GRCm39) I18N probably damaging Het
Gm5407 T C 16: 49,117,283 (GRCm39) noncoding transcript Het
Gpr89 A G 3: 96,782,949 (GRCm39) F334L possibly damaging Het
Gucy2d G T 7: 98,093,054 (GRCm39) V144F probably benign Het
H2-M10.5 C A 17: 37,085,660 (GRCm39) P273H probably damaging Het
H2-T13 T A 17: 36,391,908 (GRCm39) K237M probably damaging Het
Hcn2 A G 10: 79,566,777 (GRCm39) M485V probably benign Het
Helz2 G T 2: 180,875,543 (GRCm39) S1650R probably damaging Het
Ifnar2 T C 16: 91,201,058 (GRCm39) V433A probably benign Het
Igsf21 T A 4: 139,834,623 (GRCm39) Y83F probably benign Het
Kcnk18 A G 19: 59,223,490 (GRCm39) I212V possibly damaging Het
Kcns2 T C 15: 34,839,855 (GRCm39) I406T probably damaging Het
Krt42 C T 11: 100,158,075 (GRCm39) V166M possibly damaging Het
Lama3 T C 18: 12,628,336 (GRCm39) M1476T probably benign Het
Lcor A G 19: 41,546,913 (GRCm39) R166G probably benign Het
Mapt C T 11: 104,218,901 (GRCm39) P354L probably damaging Het
Mep1b A T 18: 21,226,286 (GRCm39) I383F probably benign Het
Mpzl1 C A 1: 165,429,374 (GRCm39) C222F probably benign Het
Mug2 T C 6: 122,047,829 (GRCm39) L780P probably damaging Het
Naip2 C T 13: 100,288,665 (GRCm39) probably null Het
Ndufab1 T C 7: 121,695,914 (GRCm39) D41G probably benign Het
Ntn1 A G 11: 68,104,011 (GRCm39) C546R probably damaging Het
Or2a5 T A 6: 42,873,687 (GRCm39) F101I probably damaging Het
Pakap A G 4: 57,892,963 (GRCm39) E880G probably damaging Het
Pde6b A G 5: 108,575,056 (GRCm39) E639G probably benign Het
Phf10 T C 17: 15,177,071 (GRCm39) T83A probably benign Het
Phkb T A 8: 86,628,549 (GRCm39) I186N possibly damaging Het
Pkhd1 A G 1: 20,636,980 (GRCm39) probably null Het
Plxnd1 C A 6: 115,954,978 (GRCm39) A595S possibly damaging Het
Ppara T A 15: 85,685,300 (GRCm39) H416Q probably damaging Het
Prodh T A 16: 17,898,891 (GRCm39) D188V probably damaging Het
Psmd14 A T 2: 61,615,800 (GRCm39) K223M possibly damaging Het
Ptpn5 A G 7: 46,728,616 (GRCm39) M528T possibly damaging Het
Rassf9 G A 10: 102,380,800 (GRCm39) E59K probably benign Het
Rnf2 A T 1: 151,351,936 (GRCm39) L140H probably damaging Het
Scai A G 2: 38,970,093 (GRCm39) F557S probably damaging Het
Sdk2 A G 11: 113,747,552 (GRCm39) S653P possibly damaging Het
Sec24c A G 14: 20,739,179 (GRCm39) D534G probably benign Het
Semp2l2a T A 8: 13,887,143 (GRCm39) Q316L probably benign Het
Septin4 T C 11: 87,457,838 (GRCm39) S71P probably benign Het
Serinc1 A G 10: 57,395,561 (GRCm39) V375A probably benign Het
Serpinb9f C T 13: 33,509,829 (GRCm39) A7V probably damaging Het
Smco1 T C 16: 32,092,700 (GRCm39) S124P probably damaging Het
Smim23 C A 11: 32,774,441 (GRCm39) C26F possibly damaging Het
Sppl2c T A 11: 104,078,715 (GRCm39) M505K probably benign Het
Sprr1b C A 3: 92,344,775 (GRCm39) V34F possibly damaging Het
Sun1 G A 5: 139,221,487 (GRCm39) probably null Het
Supt16 A G 14: 52,415,592 (GRCm39) L381P possibly damaging Het
Syne2 A G 12: 75,946,020 (GRCm39) D364G possibly damaging Het
Tax1bp1 G T 6: 52,742,937 (GRCm39) V775F probably damaging Het
Tiam1 C A 16: 89,595,582 (GRCm39) V1300L probably damaging Het
Tmem132e A G 11: 82,334,243 (GRCm39) T585A probably damaging Het
Tnni3k C T 3: 154,684,836 (GRCm39) A165T probably benign Het
Tomm40 A T 7: 19,444,886 (GRCm39) I165N probably damaging Het
Tomt T C 7: 101,550,454 (GRCm39) E104G probably damaging Het
Topaz1 T C 9: 122,596,078 (GRCm39) S950P possibly damaging Het
Traf3ip2 C G 10: 39,501,936 (GRCm39) P28R probably benign Het
Trim24 C T 6: 37,934,750 (GRCm39) P822S probably damaging Het
Upf3a T G 8: 13,842,108 (GRCm39) Y175D probably damaging Het
Vars2 G A 17: 35,977,814 (GRCm39) P69S probably benign Het
Veph1 T C 3: 66,151,976 (GRCm39) Y151C probably damaging Het
Vmn2r11 T A 5: 109,202,654 (GRCm39) D141V probably benign Het
Vwa5b1 G A 4: 138,319,331 (GRCm39) Q442* probably null Het
Wdr17 T A 8: 55,140,761 (GRCm39) D197V probably damaging Het
Wdr70 G T 15: 7,913,891 (GRCm39) T586N possibly damaging Het
Wfdc18 G A 11: 83,600,754 (GRCm39) G52R probably benign Het
Zc3h6 T C 2: 128,858,540 (GRCm39) I857T probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,723,440 (GRCm39) probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,723,450 (GRCm39) probably benign Het
Zfp647 C T 15: 76,796,151 (GRCm39) V170I probably benign Het
Zfp871 T C 17: 32,994,891 (GRCm39) N76D possibly damaging Het
Zpld2 A G 4: 133,919,986 (GRCm39) probably null Het
Zwilch A G 9: 64,068,234 (GRCm39) Y194H probably damaging Het
Other mutations in Tial1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Tial1 APN 7 128,050,069 (GRCm39) missense probably damaging 1.00
IGL02623:Tial1 APN 7 128,045,607 (GRCm39) missense probably benign 0.12
IGL02936:Tial1 APN 7 128,044,387 (GRCm39) splice site probably benign
Neoblimp UTSW 7 128,050,415 (GRCm39) missense possibly damaging 0.94
R0798:Tial1 UTSW 7 128,045,602 (GRCm39) missense probably benign 0.04
R1583:Tial1 UTSW 7 128,045,634 (GRCm39) missense probably damaging 1.00
R4863:Tial1 UTSW 7 128,056,752 (GRCm39) missense probably damaging 1.00
R5026:Tial1 UTSW 7 128,050,120 (GRCm39) missense probably damaging 0.97
R5039:Tial1 UTSW 7 128,045,692 (GRCm39) intron probably benign
R5629:Tial1 UTSW 7 128,046,421 (GRCm39) missense probably damaging 0.97
R6697:Tial1 UTSW 7 128,046,593 (GRCm39) missense possibly damaging 0.94
R8072:Tial1 UTSW 7 128,044,194 (GRCm39) missense unknown
R8178:Tial1 UTSW 7 128,046,614 (GRCm39) missense probably benign 0.01
R8937:Tial1 UTSW 7 128,056,715 (GRCm39) missense probably damaging 1.00
R9162:Tial1 UTSW 7 128,050,415 (GRCm39) missense possibly damaging 0.94
R9385:Tial1 UTSW 7 128,044,209 (GRCm39) missense unknown
Z1177:Tial1 UTSW 7 128,044,363 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCTTTGAAGAACTTGGGCAAAGAAC -3'
(R):5'- ACTGTGGAGGAATTGCTTCG -3'

Sequencing Primer
(F):5'- AATTGACACCTTTCAGTTGGC -3'
(R):5'- AATTGCTTCGGGGCTGACAG -3'
Posted On 2014-07-14