Incidental Mutation 'R1913:Phkb'
ID 214573
Institutional Source Beutler Lab
Gene Symbol Phkb
Ensembl Gene ENSMUSG00000036879
Gene Name phosphorylase kinase beta
Synonyms
MMRRC Submission 039931-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.862) question?
Stock # R1913 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 86567588-86788005 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86628549 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 186 (I186N)
Ref Sequence ENSEMBL: ENSMUSP00000124939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053771] [ENSMUST00000160611] [ENSMUST00000161850]
AlphaFold Q7TSH2
Predicted Effect possibly damaging
Transcript: ENSMUST00000053771
AA Change: I178N

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050788
Gene: ENSMUSG00000036879
AA Change: I178N

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 870 1.5e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159882
Predicted Effect probably benign
Transcript: ENSMUST00000160611
SMART Domains Protein: ENSMUSP00000125690
Gene: ENSMUSG00000036879

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 164 3.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161850
AA Change: I186N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124939
Gene: ENSMUSG00000036879
AA Change: I186N

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 47 206 3.9e-40 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, encoded by this gene, which is a member of the phosphorylase b kinase regulatory subunit family. The gamma subunit also includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9B, also known as phosphorylase kinase deficiency of liver and muscle. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. Two pseudogenes have been found on chromosomes 14 and 20, respectively.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,140,463 (GRCm39) I1588F probably benign Het
Abcc2 A T 19: 43,795,683 (GRCm39) T480S probably benign Het
Acnat1 A G 4: 49,447,498 (GRCm39) I361T probably damaging Het
Adamts10 A T 17: 33,768,529 (GRCm39) H869L probably benign Het
Agpat5 T C 8: 18,929,629 (GRCm39) C253R probably benign Het
Agtrap T A 4: 148,168,434 (GRCm39) H15L probably damaging Het
Ahnak T A 19: 8,985,286 (GRCm39) V2190E probably damaging Het
Alx4 A G 2: 93,505,732 (GRCm39) E278G probably damaging Het
Amz2 T C 11: 109,319,697 (GRCm39) S28P probably damaging Het
Atr T A 9: 95,748,786 (GRCm39) Y444N probably benign Het
Brdt T C 5: 107,496,479 (GRCm39) I197T probably benign Het
Ccser1 G T 6: 62,356,878 (GRCm39) S772I probably damaging Het
Cdh16 T C 8: 105,343,100 (GRCm39) H657R probably benign Het
Ceacam5 A T 7: 17,493,502 (GRCm39) K842* probably null Het
Cep120 G A 18: 53,856,358 (GRCm39) T353I probably benign Het
Chrnb1 T C 11: 69,684,410 (GRCm39) N164S possibly damaging Het
Cse1l T C 2: 166,764,111 (GRCm39) F123L probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dcx G C X: 142,706,099 (GRCm39) L231V probably damaging Het
Dnah12 T C 14: 26,514,221 (GRCm39) probably null Het
Dnah2 A T 11: 69,355,756 (GRCm39) M2227K probably damaging Het
Dnajc30 G A 5: 135,093,186 (GRCm39) A28T probably benign Het
Dnm1l T C 16: 16,147,830 (GRCm39) T306A probably benign Het
Elapor2 T G 5: 9,316,275 (GRCm39) L2R probably damaging Het
Enpp3 C A 10: 24,652,669 (GRCm39) E763* probably null Het
Esyt3 T C 9: 99,202,364 (GRCm39) S516G probably benign Het
Exoc3 T C 13: 74,330,435 (GRCm39) Q498R probably damaging Het
Fbn2 T A 18: 58,194,814 (GRCm39) N1449I probably damaging Het
Fgb T C 3: 82,952,287 (GRCm39) D194G probably benign Het
Fgd3 T C 13: 49,417,324 (GRCm39) D713G possibly damaging Het
Foxb1 T A 9: 69,667,383 (GRCm39) Y49F possibly damaging Het
Fpr3 A G 17: 18,191,670 (GRCm39) I314V probably damaging Het
Gfod1 A T 13: 43,456,921 (GRCm39) I18N probably damaging Het
Gm5407 T C 16: 49,117,283 (GRCm39) noncoding transcript Het
Gpr89 A G 3: 96,782,949 (GRCm39) F334L possibly damaging Het
Gucy2d G T 7: 98,093,054 (GRCm39) V144F probably benign Het
H2-M10.5 C A 17: 37,085,660 (GRCm39) P273H probably damaging Het
H2-T13 T A 17: 36,391,908 (GRCm39) K237M probably damaging Het
Hcn2 A G 10: 79,566,777 (GRCm39) M485V probably benign Het
Helz2 G T 2: 180,875,543 (GRCm39) S1650R probably damaging Het
Ifnar2 T C 16: 91,201,058 (GRCm39) V433A probably benign Het
Igsf21 T A 4: 139,834,623 (GRCm39) Y83F probably benign Het
Kcnk18 A G 19: 59,223,490 (GRCm39) I212V possibly damaging Het
Kcns2 T C 15: 34,839,855 (GRCm39) I406T probably damaging Het
Krt42 C T 11: 100,158,075 (GRCm39) V166M possibly damaging Het
Lama3 T C 18: 12,628,336 (GRCm39) M1476T probably benign Het
Lcor A G 19: 41,546,913 (GRCm39) R166G probably benign Het
Mapt C T 11: 104,218,901 (GRCm39) P354L probably damaging Het
Mep1b A T 18: 21,226,286 (GRCm39) I383F probably benign Het
Mpzl1 C A 1: 165,429,374 (GRCm39) C222F probably benign Het
Mug2 T C 6: 122,047,829 (GRCm39) L780P probably damaging Het
Naip2 C T 13: 100,288,665 (GRCm39) probably null Het
Ndufab1 T C 7: 121,695,914 (GRCm39) D41G probably benign Het
Ntn1 A G 11: 68,104,011 (GRCm39) C546R probably damaging Het
Or2a5 T A 6: 42,873,687 (GRCm39) F101I probably damaging Het
Pakap A G 4: 57,892,963 (GRCm39) E880G probably damaging Het
Pde6b A G 5: 108,575,056 (GRCm39) E639G probably benign Het
Phf10 T C 17: 15,177,071 (GRCm39) T83A probably benign Het
Pkhd1 A G 1: 20,636,980 (GRCm39) probably null Het
Plxnd1 C A 6: 115,954,978 (GRCm39) A595S possibly damaging Het
Ppara T A 15: 85,685,300 (GRCm39) H416Q probably damaging Het
Prodh T A 16: 17,898,891 (GRCm39) D188V probably damaging Het
Psmd14 A T 2: 61,615,800 (GRCm39) K223M possibly damaging Het
Ptpn5 A G 7: 46,728,616 (GRCm39) M528T possibly damaging Het
Rassf9 G A 10: 102,380,800 (GRCm39) E59K probably benign Het
Rnf2 A T 1: 151,351,936 (GRCm39) L140H probably damaging Het
Scai A G 2: 38,970,093 (GRCm39) F557S probably damaging Het
Sdk2 A G 11: 113,747,552 (GRCm39) S653P possibly damaging Het
Sec24c A G 14: 20,739,179 (GRCm39) D534G probably benign Het
Semp2l2a T A 8: 13,887,143 (GRCm39) Q316L probably benign Het
Septin4 T C 11: 87,457,838 (GRCm39) S71P probably benign Het
Serinc1 A G 10: 57,395,561 (GRCm39) V375A probably benign Het
Serpinb9f C T 13: 33,509,829 (GRCm39) A7V probably damaging Het
Smco1 T C 16: 32,092,700 (GRCm39) S124P probably damaging Het
Smim23 C A 11: 32,774,441 (GRCm39) C26F possibly damaging Het
Sppl2c T A 11: 104,078,715 (GRCm39) M505K probably benign Het
Sprr1b C A 3: 92,344,775 (GRCm39) V34F possibly damaging Het
Sun1 G A 5: 139,221,487 (GRCm39) probably null Het
Supt16 A G 14: 52,415,592 (GRCm39) L381P possibly damaging Het
Syne2 A G 12: 75,946,020 (GRCm39) D364G possibly damaging Het
Tax1bp1 G T 6: 52,742,937 (GRCm39) V775F probably damaging Het
Tial1 T A 7: 128,046,383 (GRCm39) I231F probably damaging Het
Tiam1 C A 16: 89,595,582 (GRCm39) V1300L probably damaging Het
Tmem132e A G 11: 82,334,243 (GRCm39) T585A probably damaging Het
Tnni3k C T 3: 154,684,836 (GRCm39) A165T probably benign Het
Tomm40 A T 7: 19,444,886 (GRCm39) I165N probably damaging Het
Tomt T C 7: 101,550,454 (GRCm39) E104G probably damaging Het
Topaz1 T C 9: 122,596,078 (GRCm39) S950P possibly damaging Het
Traf3ip2 C G 10: 39,501,936 (GRCm39) P28R probably benign Het
Trim24 C T 6: 37,934,750 (GRCm39) P822S probably damaging Het
Upf3a T G 8: 13,842,108 (GRCm39) Y175D probably damaging Het
Vars2 G A 17: 35,977,814 (GRCm39) P69S probably benign Het
Veph1 T C 3: 66,151,976 (GRCm39) Y151C probably damaging Het
Vmn2r11 T A 5: 109,202,654 (GRCm39) D141V probably benign Het
Vwa5b1 G A 4: 138,319,331 (GRCm39) Q442* probably null Het
Wdr17 T A 8: 55,140,761 (GRCm39) D197V probably damaging Het
Wdr70 G T 15: 7,913,891 (GRCm39) T586N possibly damaging Het
Wfdc18 G A 11: 83,600,754 (GRCm39) G52R probably benign Het
Zc3h6 T C 2: 128,858,540 (GRCm39) I857T probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,723,440 (GRCm39) probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,723,450 (GRCm39) probably benign Het
Zfp647 C T 15: 76,796,151 (GRCm39) V170I probably benign Het
Zfp871 T C 17: 32,994,891 (GRCm39) N76D possibly damaging Het
Zpld2 A G 4: 133,919,986 (GRCm39) probably null Het
Zwilch A G 9: 64,068,234 (GRCm39) Y194H probably damaging Het
Other mutations in Phkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Phkb APN 8 86,684,216 (GRCm39) missense probably benign 0.42
IGL01126:Phkb APN 8 86,672,730 (GRCm39) missense probably benign 0.12
IGL01700:Phkb APN 8 86,744,094 (GRCm39) missense probably benign 0.06
IGL01761:Phkb APN 8 86,745,693 (GRCm39) missense probably benign 0.01
IGL02404:Phkb APN 8 86,604,744 (GRCm39) missense possibly damaging 0.94
IGL02672:Phkb APN 8 86,668,987 (GRCm39) missense probably benign
IGL02682:Phkb APN 8 86,602,275 (GRCm39) makesense probably null
IGL02693:Phkb APN 8 86,668,863 (GRCm39) missense probably damaging 1.00
IGL02798:Phkb APN 8 86,770,406 (GRCm39) missense probably benign
IGL02888:Phkb APN 8 86,662,101 (GRCm39) critical splice donor site probably null
IGL03106:Phkb APN 8 86,745,095 (GRCm39) splice site probably benign
PIT4544001:Phkb UTSW 8 86,738,266 (GRCm39) missense probably benign 0.42
R0088:Phkb UTSW 8 86,669,020 (GRCm39) critical splice donor site probably null
R0107:Phkb UTSW 8 86,743,560 (GRCm39) missense probably benign 0.01
R0504:Phkb UTSW 8 86,783,153 (GRCm39) missense probably benign
R0569:Phkb UTSW 8 86,744,031 (GRCm39) missense probably damaging 1.00
R0671:Phkb UTSW 8 86,602,322 (GRCm39) missense probably damaging 0.97
R0894:Phkb UTSW 8 86,744,070 (GRCm39) missense probably damaging 1.00
R1491:Phkb UTSW 8 86,602,286 (GRCm39) missense possibly damaging 0.90
R1502:Phkb UTSW 8 86,785,968 (GRCm39) missense possibly damaging 0.69
R1595:Phkb UTSW 8 86,753,182 (GRCm39) splice site probably benign
R1686:Phkb UTSW 8 86,748,278 (GRCm39) missense probably benign
R1919:Phkb UTSW 8 86,648,790 (GRCm39) missense probably benign 0.17
R1968:Phkb UTSW 8 86,697,580 (GRCm39) missense probably benign 0.07
R2008:Phkb UTSW 8 86,783,096 (GRCm39) missense probably damaging 1.00
R2051:Phkb UTSW 8 86,776,450 (GRCm39) critical splice donor site probably null
R2148:Phkb UTSW 8 86,744,115 (GRCm39) missense probably damaging 0.96
R2305:Phkb UTSW 8 86,770,431 (GRCm39) missense possibly damaging 0.80
R3801:Phkb UTSW 8 86,648,858 (GRCm39) nonsense probably null
R3804:Phkb UTSW 8 86,648,858 (GRCm39) nonsense probably null
R4159:Phkb UTSW 8 86,748,162 (GRCm39) splice site probably null
R4624:Phkb UTSW 8 86,575,341 (GRCm39) intron probably benign
R4833:Phkb UTSW 8 86,628,540 (GRCm39) missense probably damaging 1.00
R5017:Phkb UTSW 8 86,776,438 (GRCm39) missense probably benign
R5169:Phkb UTSW 8 86,623,120 (GRCm39) missense probably benign 0.01
R5337:Phkb UTSW 8 86,604,874 (GRCm39) missense probably damaging 1.00
R5391:Phkb UTSW 8 86,744,097 (GRCm39) missense probably damaging 1.00
R5395:Phkb UTSW 8 86,744,097 (GRCm39) missense probably damaging 1.00
R5480:Phkb UTSW 8 86,648,811 (GRCm39) missense probably damaging 1.00
R5538:Phkb UTSW 8 86,648,756 (GRCm39) missense possibly damaging 0.80
R5623:Phkb UTSW 8 86,569,677 (GRCm39) unclassified probably benign
R5753:Phkb UTSW 8 86,604,859 (GRCm39) missense probably damaging 1.00
R5909:Phkb UTSW 8 86,748,076 (GRCm39) critical splice donor site probably null
R5929:Phkb UTSW 8 86,697,543 (GRCm39) missense probably benign 0.01
R6093:Phkb UTSW 8 86,668,958 (GRCm39) missense probably damaging 1.00
R6320:Phkb UTSW 8 86,602,327 (GRCm39) missense probably benign 0.00
R6324:Phkb UTSW 8 86,745,171 (GRCm39) missense probably benign 0.00
R6626:Phkb UTSW 8 86,648,780 (GRCm39) missense probably damaging 0.96
R6687:Phkb UTSW 8 86,756,175 (GRCm39) missense probably damaging 1.00
R6848:Phkb UTSW 8 86,756,246 (GRCm39) missense probably damaging 0.99
R7228:Phkb UTSW 8 86,569,636 (GRCm39) unclassified probably benign
R7260:Phkb UTSW 8 86,604,759 (GRCm39) missense probably benign 0.07
R7271:Phkb UTSW 8 86,770,418 (GRCm39) missense probably damaging 1.00
R7314:Phkb UTSW 8 86,669,021 (GRCm39) splice site probably null
R7586:Phkb UTSW 8 86,756,226 (GRCm39) missense probably damaging 1.00
R7654:Phkb UTSW 8 86,667,516 (GRCm39) missense possibly damaging 0.91
R7958:Phkb UTSW 8 86,748,292 (GRCm39) missense probably benign 0.00
R8269:Phkb UTSW 8 86,756,211 (GRCm39) missense probably benign 0.42
R8811:Phkb UTSW 8 86,745,156 (GRCm39) missense possibly damaging 0.58
R8967:Phkb UTSW 8 86,756,063 (GRCm39) intron probably benign
R9176:Phkb UTSW 8 86,697,623 (GRCm39) missense probably damaging 0.96
R9350:Phkb UTSW 8 86,743,493 (GRCm39) nonsense probably null
R9465:Phkb UTSW 8 86,623,059 (GRCm39) missense probably damaging 1.00
R9480:Phkb UTSW 8 86,684,216 (GRCm39) missense probably benign 0.42
R9490:Phkb UTSW 8 86,628,525 (GRCm39) missense probably damaging 0.97
R9700:Phkb UTSW 8 86,567,696 (GRCm39) missense probably benign 0.01
R9708:Phkb UTSW 8 86,783,119 (GRCm39) missense probably benign 0.02
R9716:Phkb UTSW 8 86,604,798 (GRCm39) missense probably null 0.00
X0021:Phkb UTSW 8 86,756,264 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGCTTCCATTAGGTTCATTT -3'
(R):5'- TGAAACCATTCATTTCATACACCAAA -3'

Sequencing Primer
(F):5'- CTGACACTATTGGAGAAAATGA -3'
(R):5'- CATTCATCTTTTATCAAACT -3'
Posted On 2014-07-14