Incidental Mutation 'R1913:Phkb'
ID214573
Institutional Source Beutler Lab
Gene Symbol Phkb
Ensembl Gene ENSMUSG00000036879
Gene Namephosphorylase kinase beta
Synonyms
MMRRC Submission 039931-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R1913 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85840959-86061376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85901920 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 186 (I186N)
Ref Sequence ENSEMBL: ENSMUSP00000124939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053771] [ENSMUST00000160611] [ENSMUST00000161850]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053771
AA Change: I178N

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050788
Gene: ENSMUSG00000036879
AA Change: I178N

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 870 1.5e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159882
Predicted Effect probably benign
Transcript: ENSMUST00000160611
SMART Domains Protein: ENSMUSP00000125690
Gene: ENSMUSG00000036879

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 164 3.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161850
AA Change: I186N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124939
Gene: ENSMUSG00000036879
AA Change: I186N

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 47 206 3.9e-40 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, encoded by this gene, which is a member of the phosphorylase b kinase regulatory subunit family. The gamma subunit also includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9B, also known as phosphorylase kinase deficiency of liver and muscle. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. Two pseudogenes have been found on chromosomes 14 and 20, respectively.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T G 5: 9,266,275 L2R probably damaging Het
Abca16 A T 7: 120,541,240 I1588F probably benign Het
Abcc2 A T 19: 43,807,244 T480S probably benign Het
Acnat1 A G 4: 49,447,498 I361T probably damaging Het
Adamts10 A T 17: 33,549,555 H869L probably benign Het
AF366264 T A 8: 13,837,143 Q316L probably benign Het
Agpat5 T C 8: 18,879,613 C253R probably benign Het
Agtrap T A 4: 148,083,977 H15L probably damaging Het
Ahnak T A 19: 9,007,922 V2190E probably damaging Het
Alx4 A G 2: 93,675,387 E278G probably damaging Het
Amz2 T C 11: 109,428,871 S28P probably damaging Het
Atr T A 9: 95,866,733 Y444N probably benign Het
Brdt T C 5: 107,348,613 I197T probably benign Het
Ccser1 G T 6: 62,379,894 S772I probably damaging Het
Cdh16 T C 8: 104,616,468 H657R probably benign Het
Ceacam5 A T 7: 17,759,577 K842* probably null Het
Cep120 G A 18: 53,723,286 T353I probably benign Het
Chrnb1 T C 11: 69,793,584 N164S possibly damaging Het
Cse1l T C 2: 166,922,191 F123L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dcx G C X: 143,923,103 L231V probably damaging Het
Dnah12 T C 14: 26,792,264 probably null Het
Dnah2 A T 11: 69,464,930 M2227K probably damaging Het
Dnajc30 G A 5: 135,064,332 A28T probably benign Het
Dnm1l T C 16: 16,329,966 T306A probably benign Het
Enpp3 C A 10: 24,776,771 E763* probably null Het
Esyt3 T C 9: 99,320,311 S516G probably benign Het
Exoc3 T C 13: 74,182,316 Q498R probably damaging Het
Fbn2 T A 18: 58,061,742 N1449I probably damaging Het
Fgb T C 3: 83,044,980 D194G probably benign Het
Fgd3 T C 13: 49,263,848 D713G possibly damaging Het
Foxb1 T A 9: 69,760,101 Y49F possibly damaging Het
Fpr3 A G 17: 17,971,408 I314V probably damaging Het
Gfod1 A T 13: 43,303,445 I18N probably damaging Het
Gm11492 T C 11: 87,567,012 S71P probably benign Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm7534 A G 4: 134,192,675 probably null Het
Gpr89 A G 3: 96,875,633 F334L possibly damaging Het
Gucy2d G T 7: 98,443,847 V144F probably benign Het
H2-Bl T A 17: 36,081,016 K237M probably damaging Het
H2-M10.5 C A 17: 36,774,768 P273H probably damaging Het
Hcn2 A G 10: 79,730,943 M485V probably benign Het
Helz2 G T 2: 181,233,750 S1650R probably damaging Het
Ifnar2 T C 16: 91,404,170 V433A probably benign Het
Igsf21 T A 4: 140,107,312 Y83F probably benign Het
Kcnk18 A G 19: 59,235,058 I212V possibly damaging Het
Kcns2 T C 15: 34,839,709 I406T probably damaging Het
Krt42 C T 11: 100,267,249 V166M possibly damaging Het
Lama3 T C 18: 12,495,279 M1476T probably benign Het
Lcor A G 19: 41,558,474 R166G probably benign Het
Mapt C T 11: 104,328,075 P354L probably damaging Het
Mep1b A T 18: 21,093,229 I383F probably benign Het
Mpzl1 C A 1: 165,601,805 C222F probably benign Het
Mug2 T C 6: 122,070,870 L780P probably damaging Het
Naip2 C T 13: 100,152,157 probably null Het
Ndufab1 T C 7: 122,096,691 D41G probably benign Het
Ntn1 A G 11: 68,213,185 C546R probably damaging Het
Olfr448 T A 6: 42,896,753 F101I probably damaging Het
Pakap A G 4: 57,892,963 E880G probably damaging Het
Pde6b A G 5: 108,427,190 E639G probably benign Het
Phf10 T C 17: 14,956,809 T83A probably benign Het
Pkhd1 A G 1: 20,566,756 probably null Het
Plxnd1 C A 6: 115,978,017 A595S possibly damaging Het
Ppara T A 15: 85,801,099 H416Q probably damaging Het
Prodh T A 16: 18,081,027 D188V probably damaging Het
Psmd14 A T 2: 61,785,456 K223M possibly damaging Het
Ptpn5 A G 7: 47,078,868 M528T possibly damaging Het
Rassf9 G A 10: 102,544,939 E59K probably benign Het
Rnf2 A T 1: 151,476,185 L140H probably damaging Het
Scai A G 2: 39,080,081 F557S probably damaging Het
Sdk2 A G 11: 113,856,726 S653P possibly damaging Het
Sec24c A G 14: 20,689,111 D534G probably benign Het
Serinc1 A G 10: 57,519,465 V375A probably benign Het
Serpinb9f C T 13: 33,325,846 A7V probably damaging Het
Smco1 T C 16: 32,273,882 S124P probably damaging Het
Smim23 C A 11: 32,824,441 C26F possibly damaging Het
Sppl2c T A 11: 104,187,889 M505K probably benign Het
Sprr1b C A 3: 92,437,468 V34F possibly damaging Het
Sun1 G A 5: 139,235,732 probably null Het
Supt16 A G 14: 52,178,135 L381P possibly damaging Het
Syne2 A G 12: 75,899,246 D364G possibly damaging Het
Tax1bp1 G T 6: 52,765,952 V775F probably damaging Het
Tial1 T A 7: 128,444,659 I231F probably damaging Het
Tiam1 C A 16: 89,798,694 V1300L probably damaging Het
Tmem132e A G 11: 82,443,417 T585A probably damaging Het
Tnni3k C T 3: 154,979,199 A165T probably benign Het
Tomm40 A T 7: 19,710,961 I165N probably damaging Het
Tomt T C 7: 101,901,247 E104G probably damaging Het
Topaz1 T C 9: 122,767,013 S950P possibly damaging Het
Traf3ip2 C G 10: 39,625,940 P28R probably benign Het
Trim24 C T 6: 37,957,815 P822S probably damaging Het
Upf3a T G 8: 13,792,108 Y175D probably damaging Het
Vars2 G A 17: 35,666,922 P69S probably benign Het
Veph1 T C 3: 66,244,555 Y151C probably damaging Het
Vmn2r11 T A 5: 109,054,788 D141V probably benign Het
Vwa5b1 G A 4: 138,592,020 Q442* probably null Het
Wdr17 T A 8: 54,687,726 D197V probably damaging Het
Wdr70 G T 15: 7,884,410 T586N possibly damaging Het
Wfdc18 G A 11: 83,709,928 G52R probably benign Het
Zc3h6 T C 2: 129,016,620 I857T probably damaging Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,412,524 probably benign Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp647 C T 15: 76,911,951 V170I probably benign Het
Zfp871 T C 17: 32,775,917 N76D possibly damaging Het
Zwilch A G 9: 64,160,952 Y194H probably damaging Het
Other mutations in Phkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Phkb APN 8 85957587 missense probably benign 0.42
IGL01126:Phkb APN 8 85946101 missense probably benign 0.12
IGL01700:Phkb APN 8 86017465 missense probably benign 0.06
IGL01761:Phkb APN 8 86019064 missense probably benign 0.01
IGL02404:Phkb APN 8 85878115 missense possibly damaging 0.94
IGL02672:Phkb APN 8 85942358 missense probably benign
IGL02682:Phkb APN 8 85875646 makesense probably null
IGL02693:Phkb APN 8 85942234 missense probably damaging 1.00
IGL02798:Phkb APN 8 86043777 missense probably benign
IGL02888:Phkb APN 8 85935472 critical splice donor site probably null
IGL03106:Phkb APN 8 86018466 splice site probably benign
PIT4544001:Phkb UTSW 8 86011637 missense probably benign 0.42
R0088:Phkb UTSW 8 85942391 critical splice donor site probably null
R0107:Phkb UTSW 8 86016931 missense probably benign 0.01
R0504:Phkb UTSW 8 86056524 missense probably benign
R0569:Phkb UTSW 8 86017402 missense probably damaging 1.00
R0671:Phkb UTSW 8 85875693 missense probably damaging 0.97
R0894:Phkb UTSW 8 86017441 missense probably damaging 1.00
R1491:Phkb UTSW 8 85875657 missense possibly damaging 0.90
R1502:Phkb UTSW 8 86059339 missense possibly damaging 0.69
R1595:Phkb UTSW 8 86026553 splice site probably benign
R1686:Phkb UTSW 8 86021649 missense probably benign
R1919:Phkb UTSW 8 85922161 missense probably benign 0.17
R1968:Phkb UTSW 8 85970951 missense probably benign 0.07
R2008:Phkb UTSW 8 86056467 missense probably damaging 1.00
R2051:Phkb UTSW 8 86049821 critical splice donor site probably null
R2148:Phkb UTSW 8 86017486 missense probably damaging 0.96
R2305:Phkb UTSW 8 86043802 missense possibly damaging 0.80
R3801:Phkb UTSW 8 85922229 nonsense probably null
R3804:Phkb UTSW 8 85922229 nonsense probably null
R4159:Phkb UTSW 8 86021533 splice site probably null
R4624:Phkb UTSW 8 85848712 intron probably benign
R4833:Phkb UTSW 8 85901911 missense probably damaging 1.00
R5017:Phkb UTSW 8 86049809 missense probably benign
R5169:Phkb UTSW 8 85896491 missense probably benign 0.01
R5337:Phkb UTSW 8 85878245 missense probably damaging 1.00
R5391:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5395:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5480:Phkb UTSW 8 85922182 missense probably damaging 1.00
R5538:Phkb UTSW 8 85922127 missense possibly damaging 0.80
R5623:Phkb UTSW 8 85843048 unclassified probably benign
R5753:Phkb UTSW 8 85878230 missense probably damaging 1.00
R5909:Phkb UTSW 8 86021447 critical splice donor site probably null
R5929:Phkb UTSW 8 85970914 missense probably benign 0.01
R6093:Phkb UTSW 8 85942329 missense probably damaging 1.00
R6320:Phkb UTSW 8 85875698 missense probably benign 0.00
R6324:Phkb UTSW 8 86018542 missense probably benign 0.00
R6626:Phkb UTSW 8 85922151 missense probably damaging 0.96
R6687:Phkb UTSW 8 86029546 missense probably damaging 1.00
R6848:Phkb UTSW 8 86029617 missense probably damaging 0.99
R7228:Phkb UTSW 8 85843007 unclassified probably benign
R7260:Phkb UTSW 8 85878130 missense probably benign 0.07
R7271:Phkb UTSW 8 86043789 missense probably damaging 1.00
R7314:Phkb UTSW 8 85942392 splice site probably null
R7586:Phkb UTSW 8 86029597 missense probably damaging 1.00
R7654:Phkb UTSW 8 85940887 missense possibly damaging 0.91
X0021:Phkb UTSW 8 86029635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGCTTCCATTAGGTTCATTT -3'
(R):5'- TGAAACCATTCATTTCATACACCAAA -3'

Sequencing Primer
(F):5'- CTGACACTATTGGAGAAAATGA -3'
(R):5'- CATTCATCTTTTATCAAACT -3'
Posted On2014-07-14