Incidental Mutation 'R1913:Traf3ip2'
ID214582
Institutional Source Beutler Lab
Gene Symbol Traf3ip2
Ensembl Gene ENSMUSG00000019842
Gene NameTRAF3 interacting protein 2
SynonymsAct1
MMRRC Submission 039931-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1913 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location39612934-39655307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 39625940 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 28 (P28R)
Ref Sequence ENSEMBL: ENSMUSP00000019987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019987]
Predicted Effect probably benign
Transcript: ENSMUST00000019987
AA Change: P28R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019987
Gene: ENSMUSG00000019842
AA Change: P28R

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 164 179 N/A INTRINSIC
Pfam:SEFIR 391 533 1.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153261
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for one null allele exhibit splenomegaly, lymphadenopathy, increased number of B cells, defective IL-17 signaling, and increased immunoglobulin levels (including auto-antibodies) whereas mice homozygous for another null allele lack these features except the defect in IL-17 signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T G 5: 9,266,275 L2R probably damaging Het
Abca16 A T 7: 120,541,240 I1588F probably benign Het
Abcc2 A T 19: 43,807,244 T480S probably benign Het
Acnat1 A G 4: 49,447,498 I361T probably damaging Het
Adamts10 A T 17: 33,549,555 H869L probably benign Het
AF366264 T A 8: 13,837,143 Q316L probably benign Het
Agpat5 T C 8: 18,879,613 C253R probably benign Het
Agtrap T A 4: 148,083,977 H15L probably damaging Het
Ahnak T A 19: 9,007,922 V2190E probably damaging Het
Alx4 A G 2: 93,675,387 E278G probably damaging Het
Amz2 T C 11: 109,428,871 S28P probably damaging Het
Atr T A 9: 95,866,733 Y444N probably benign Het
Brdt T C 5: 107,348,613 I197T probably benign Het
Ccser1 G T 6: 62,379,894 S772I probably damaging Het
Cdh16 T C 8: 104,616,468 H657R probably benign Het
Ceacam5 A T 7: 17,759,577 K842* probably null Het
Cep120 G A 18: 53,723,286 T353I probably benign Het
Chrnb1 T C 11: 69,793,584 N164S possibly damaging Het
Cse1l T C 2: 166,922,191 F123L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dcx G C X: 143,923,103 L231V probably damaging Het
Dnah12 T C 14: 26,792,264 probably null Het
Dnah2 A T 11: 69,464,930 M2227K probably damaging Het
Dnajc30 G A 5: 135,064,332 A28T probably benign Het
Dnm1l T C 16: 16,329,966 T306A probably benign Het
Enpp3 C A 10: 24,776,771 E763* probably null Het
Esyt3 T C 9: 99,320,311 S516G probably benign Het
Exoc3 T C 13: 74,182,316 Q498R probably damaging Het
Fbn2 T A 18: 58,061,742 N1449I probably damaging Het
Fgb T C 3: 83,044,980 D194G probably benign Het
Fgd3 T C 13: 49,263,848 D713G possibly damaging Het
Foxb1 T A 9: 69,760,101 Y49F possibly damaging Het
Fpr3 A G 17: 17,971,408 I314V probably damaging Het
Gfod1 A T 13: 43,303,445 I18N probably damaging Het
Gm11492 T C 11: 87,567,012 S71P probably benign Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm7534 A G 4: 134,192,675 probably null Het
Gpr89 A G 3: 96,875,633 F334L possibly damaging Het
Gucy2d G T 7: 98,443,847 V144F probably benign Het
H2-Bl T A 17: 36,081,016 K237M probably damaging Het
H2-M10.5 C A 17: 36,774,768 P273H probably damaging Het
Hcn2 A G 10: 79,730,943 M485V probably benign Het
Helz2 G T 2: 181,233,750 S1650R probably damaging Het
Ifnar2 T C 16: 91,404,170 V433A probably benign Het
Igsf21 T A 4: 140,107,312 Y83F probably benign Het
Kcnk18 A G 19: 59,235,058 I212V possibly damaging Het
Kcns2 T C 15: 34,839,709 I406T probably damaging Het
Krt42 C T 11: 100,267,249 V166M possibly damaging Het
Lama3 T C 18: 12,495,279 M1476T probably benign Het
Lcor A G 19: 41,558,474 R166G probably benign Het
Mapt C T 11: 104,328,075 P354L probably damaging Het
Mep1b A T 18: 21,093,229 I383F probably benign Het
Mpzl1 C A 1: 165,601,805 C222F probably benign Het
Mug2 T C 6: 122,070,870 L780P probably damaging Het
Naip2 C T 13: 100,152,157 probably null Het
Ndufab1 T C 7: 122,096,691 D41G probably benign Het
Ntn1 A G 11: 68,213,185 C546R probably damaging Het
Olfr448 T A 6: 42,896,753 F101I probably damaging Het
Pakap A G 4: 57,892,963 E880G probably damaging Het
Pde6b A G 5: 108,427,190 E639G probably benign Het
Phf10 T C 17: 14,956,809 T83A probably benign Het
Phkb T A 8: 85,901,920 I186N possibly damaging Het
Pkhd1 A G 1: 20,566,756 probably null Het
Plxnd1 C A 6: 115,978,017 A595S possibly damaging Het
Ppara T A 15: 85,801,099 H416Q probably damaging Het
Prodh T A 16: 18,081,027 D188V probably damaging Het
Psmd14 A T 2: 61,785,456 K223M possibly damaging Het
Ptpn5 A G 7: 47,078,868 M528T possibly damaging Het
Rassf9 G A 10: 102,544,939 E59K probably benign Het
Rnf2 A T 1: 151,476,185 L140H probably damaging Het
Scai A G 2: 39,080,081 F557S probably damaging Het
Sdk2 A G 11: 113,856,726 S653P possibly damaging Het
Sec24c A G 14: 20,689,111 D534G probably benign Het
Serinc1 A G 10: 57,519,465 V375A probably benign Het
Serpinb9f C T 13: 33,325,846 A7V probably damaging Het
Smco1 T C 16: 32,273,882 S124P probably damaging Het
Smim23 C A 11: 32,824,441 C26F possibly damaging Het
Sppl2c T A 11: 104,187,889 M505K probably benign Het
Sprr1b C A 3: 92,437,468 V34F possibly damaging Het
Sun1 G A 5: 139,235,732 probably null Het
Supt16 A G 14: 52,178,135 L381P possibly damaging Het
Syne2 A G 12: 75,899,246 D364G possibly damaging Het
Tax1bp1 G T 6: 52,765,952 V775F probably damaging Het
Tial1 T A 7: 128,444,659 I231F probably damaging Het
Tiam1 C A 16: 89,798,694 V1300L probably damaging Het
Tmem132e A G 11: 82,443,417 T585A probably damaging Het
Tnni3k C T 3: 154,979,199 A165T probably benign Het
Tomm40 A T 7: 19,710,961 I165N probably damaging Het
Tomt T C 7: 101,901,247 E104G probably damaging Het
Topaz1 T C 9: 122,767,013 S950P possibly damaging Het
Trim24 C T 6: 37,957,815 P822S probably damaging Het
Upf3a T G 8: 13,792,108 Y175D probably damaging Het
Vars2 G A 17: 35,666,922 P69S probably benign Het
Veph1 T C 3: 66,244,555 Y151C probably damaging Het
Vmn2r11 T A 5: 109,054,788 D141V probably benign Het
Vwa5b1 G A 4: 138,592,020 Q442* probably null Het
Wdr17 T A 8: 54,687,726 D197V probably damaging Het
Wdr70 G T 15: 7,884,410 T586N possibly damaging Het
Wfdc18 G A 11: 83,709,928 G52R probably benign Het
Zc3h6 T C 2: 129,016,620 I857T probably damaging Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,412,524 probably benign Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp647 C T 15: 76,911,951 V170I probably benign Het
Zfp871 T C 17: 32,775,917 N76D possibly damaging Het
Zwilch A G 9: 64,160,952 Y194H probably damaging Het
Other mutations in Traf3ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Traf3ip2 APN 10 39634660 missense probably benign
IGL02097:Traf3ip2 APN 10 39654479 missense probably damaging 0.99
IGL02530:Traf3ip2 APN 10 39646906 missense possibly damaging 0.80
IGL02957:Traf3ip2 APN 10 39654410 missense probably damaging 1.00
IGL03034:Traf3ip2 APN 10 39626219 missense probably damaging 1.00
IGL03123:Traf3ip2 APN 10 39639222 missense possibly damaging 0.87
IGL03386:Traf3ip2 APN 10 39645708 missense probably benign 0.03
R0328:Traf3ip2 UTSW 10 39634673 missense probably damaging 0.96
R1282:Traf3ip2 UTSW 10 39626405 missense probably damaging 1.00
R2975:Traf3ip2 UTSW 10 39626540 missense probably benign 0.00
R4575:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4576:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4578:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4670:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4680:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4681:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4710:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4742:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4760:Traf3ip2 UTSW 10 39645739 missense probably damaging 1.00
R4934:Traf3ip2 UTSW 10 39626100 missense probably damaging 1.00
R5079:Traf3ip2 UTSW 10 39626477 missense probably damaging 1.00
R5959:Traf3ip2 UTSW 10 39641341 missense probably benign 0.13
R6421:Traf3ip2 UTSW 10 39639404 splice site probably null
R6462:Traf3ip2 UTSW 10 39639247 missense probably benign 0.00
R7156:Traf3ip2 UTSW 10 39626177 missense possibly damaging 0.61
X0020:Traf3ip2 UTSW 10 39654519 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCACAATGCTGTCACACTACTG -3'
(R):5'- CCAAGTTCAGGGTGCCTTCTAAAG -3'

Sequencing Primer
(F):5'- TGTTAATTTAAACCACATCCTGAACC -3'
(R):5'- GGTGCCTTCTAAAGAAACTGGCTTC -3'
Posted On2014-07-14