Mutagenetix > Incidental Mutation

Incidental Mutation 'R1913:Traf3ip2'

214582

Institutional Source

Beutler Lab

Gene Symbol

Traf3ip2

Ensembl Gene

ENSMUSG00000019842

Gene Name

TRAF3 interacting protein 2

Synonyms

Act1

MMRRC Submission

039931-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R1913 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39612934-39655307 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 39625940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Arginine at position 28 (P28R)

Ref Sequence

ENSEMBL: ENSMUSP00000019987 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019987]

AlphaFold

Q8N7N6

Predicted Effect

probably benign
Transcript: ENSMUST00000019987
AA Change: P28R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000019987
Gene: ENSMUSG00000019842
AA Change: P28R

Domain	Start	End	E-Value	Type
low complexity region	22	37	N/A	INTRINSIC
low complexity region	94	106	N/A	INTRINSIC
low complexity region	164	179	N/A	INTRINSIC
Pfam:SEFIR	391	533	1.2e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129191

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133302

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139429

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143651

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151921

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153261

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for one null allele exhibit splenomegaly, lymphadenopathy, increased number of B cells, defective IL-17 signaling, and increased immunoglobulin levels (including auto-antibodies) whereas mice homozygous for another null allele lack these features except the defect in IL-17 signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	G	5: 9,266,275	L2R	probably damaging	Het
Abca16	A	T	7: 120,541,240	I1588F	probably benign	Het
Abcc2	A	T	19: 43,807,244	T480S	probably benign	Het
Acnat1	A	G	4: 49,447,498	I361T	probably damaging	Het
Adamts10	A	T	17: 33,549,555	H869L	probably benign	Het
AF366264	T	A	8: 13,837,143	Q316L	probably benign	Het
Agpat5	T	C	8: 18,879,613	C253R	probably benign	Het
Agtrap	T	A	4: 148,083,977	H15L	probably damaging	Het
Ahnak	T	A	19: 9,007,922	V2190E	probably damaging	Het
Alx4	A	G	2: 93,675,387	E278G	probably damaging	Het
Amz2	T	C	11: 109,428,871	S28P	probably damaging	Het
Atr	T	A	9: 95,866,733	Y444N	probably benign	Het
Brdt	T	C	5: 107,348,613	I197T	probably benign	Het
Ccser1	G	T	6: 62,379,894	S772I	probably damaging	Het
Cdh16	T	C	8: 104,616,468	H657R	probably benign	Het
Ceacam5	A	T	7: 17,759,577	K842*	probably null	Het
Cep120	G	A	18: 53,723,286	T353I	probably benign	Het
Chrnb1	T	C	11: 69,793,584	N164S	possibly damaging	Het
Cse1l	T	C	2: 166,922,191	F123L	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dcx	G	C	X: 143,923,103	L231V	probably damaging	Het
Dnah12	T	C	14: 26,792,264		probably null	Het
Dnah2	A	T	11: 69,464,930	M2227K	probably damaging	Het
Dnajc30	G	A	5: 135,064,332	A28T	probably benign	Het
Dnm1l	T	C	16: 16,329,966	T306A	probably benign	Het
Enpp3	C	A	10: 24,776,771	E763*	probably null	Het
Esyt3	T	C	9: 99,320,311	S516G	probably benign	Het
Exoc3	T	C	13: 74,182,316	Q498R	probably damaging	Het
Fbn2	T	A	18: 58,061,742	N1449I	probably damaging	Het
Fgb	T	C	3: 83,044,980	D194G	probably benign	Het
Fgd3	T	C	13: 49,263,848	D713G	possibly damaging	Het
Foxb1	T	A	9: 69,760,101	Y49F	possibly damaging	Het
Fpr3	A	G	17: 17,971,408	I314V	probably damaging	Het
Gfod1	A	T	13: 43,303,445	I18N	probably damaging	Het
Gm11492	T	C	11: 87,567,012	S71P	probably benign	Het
Gm5407	T	C	16: 49,296,920		noncoding transcript	Het
Gm7534	A	G	4: 134,192,675		probably null	Het
Gpr89	A	G	3: 96,875,633	F334L	possibly damaging	Het
Gucy2d	G	T	7: 98,443,847	V144F	probably benign	Het
H2-Bl	T	A	17: 36,081,016	K237M	probably damaging	Het
H2-M10.5	C	A	17: 36,774,768	P273H	probably damaging	Het
Hcn2	A	G	10: 79,730,943	M485V	probably benign	Het
Helz2	G	T	2: 181,233,750	S1650R	probably damaging	Het
Ifnar2	T	C	16: 91,404,170	V433A	probably benign	Het
Igsf21	T	A	4: 140,107,312	Y83F	probably benign	Het
Kcnk18	A	G	19: 59,235,058	I212V	possibly damaging	Het
Kcns2	T	C	15: 34,839,709	I406T	probably damaging	Het
Krt42	C	T	11: 100,267,249	V166M	possibly damaging	Het
Lama3	T	C	18: 12,495,279	M1476T	probably benign	Het
Lcor	A	G	19: 41,558,474	R166G	probably benign	Het
Mapt	C	T	11: 104,328,075	P354L	probably damaging	Het
Mep1b	A	T	18: 21,093,229	I383F	probably benign	Het
Mpzl1	C	A	1: 165,601,805	C222F	probably benign	Het
Mug2	T	C	6: 122,070,870	L780P	probably damaging	Het
Naip2	C	T	13: 100,152,157		probably null	Het
Ndufab1	T	C	7: 122,096,691	D41G	probably benign	Het
Ntn1	A	G	11: 68,213,185	C546R	probably damaging	Het
Olfr448	T	A	6: 42,896,753	F101I	probably damaging	Het
Pakap	A	G	4: 57,892,963	E880G	probably damaging	Het
Pde6b	A	G	5: 108,427,190	E639G	probably benign	Het
Phf10	T	C	17: 14,956,809	T83A	probably benign	Het
Phkb	T	A	8: 85,901,920	I186N	possibly damaging	Het
Pkhd1	A	G	1: 20,566,756		probably null	Het
Plxnd1	C	A	6: 115,978,017	A595S	possibly damaging	Het
Ppara	T	A	15: 85,801,099	H416Q	probably damaging	Het
Prodh	T	A	16: 18,081,027	D188V	probably damaging	Het
Psmd14	A	T	2: 61,785,456	K223M	possibly damaging	Het
Ptpn5	A	G	7: 47,078,868	M528T	possibly damaging	Het
Rassf9	G	A	10: 102,544,939	E59K	probably benign	Het
Rnf2	A	T	1: 151,476,185	L140H	probably damaging	Het
Scai	A	G	2: 39,080,081	F557S	probably damaging	Het
Sdk2	A	G	11: 113,856,726	S653P	possibly damaging	Het
Sec24c	A	G	14: 20,689,111	D534G	probably benign	Het
Serinc1	A	G	10: 57,519,465	V375A	probably benign	Het
Serpinb9f	C	T	13: 33,325,846	A7V	probably damaging	Het
Smco1	T	C	16: 32,273,882	S124P	probably damaging	Het
Smim23	C	A	11: 32,824,441	C26F	possibly damaging	Het
Sppl2c	T	A	11: 104,187,889	M505K	probably benign	Het
Sprr1b	C	A	3: 92,437,468	V34F	possibly damaging	Het
Sun1	G	A	5: 139,235,732		probably null	Het
Supt16	A	G	14: 52,178,135	L381P	possibly damaging	Het
Syne2	A	G	12: 75,899,246	D364G	possibly damaging	Het
Tax1bp1	G	T	6: 52,765,952	V775F	probably damaging	Het
Tial1	T	A	7: 128,444,659	I231F	probably damaging	Het
Tiam1	C	A	16: 89,798,694	V1300L	probably damaging	Het
Tmem132e	A	G	11: 82,443,417	T585A	probably damaging	Het
Tnni3k	C	T	3: 154,979,199	A165T	probably benign	Het
Tomm40	A	T	7: 19,710,961	I165N	probably damaging	Het
Tomt	T	C	7: 101,901,247	E104G	probably damaging	Het
Topaz1	T	C	9: 122,767,013	S950P	possibly damaging	Het
Trim24	C	T	6: 37,957,815	P822S	probably damaging	Het
Upf3a	T	G	8: 13,792,108	Y175D	probably damaging	Het
Vars2	G	A	17: 35,666,922	P69S	probably benign	Het
Veph1	T	C	3: 66,244,555	Y151C	probably damaging	Het
Vmn2r11	T	A	5: 109,054,788	D141V	probably benign	Het
Vwa5b1	G	A	4: 138,592,020	Q442*	probably null	Het
Wdr17	T	A	8: 54,687,726	D197V	probably damaging	Het
Wdr70	G	T	15: 7,884,410	T586N	possibly damaging	Het
Wfdc18	G	A	11: 83,709,928	G52R	probably benign	Het
Zc3h6	T	C	2: 129,016,620	I857T	probably damaging	Het
Zfp318	GAAGAA	GAAGAACAAGAA	17: 46,412,524		probably benign	Het
Zfp318	TGAAGAAGAAGAAGAAGAAGAAGAAGAAG	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG	17: 46,412,514		probably benign	Het
Zfp647	C	T	15: 76,911,951	V170I	probably benign	Het
Zfp871	T	C	17: 32,775,917	N76D	possibly damaging	Het
Zwilch	A	G	9: 64,160,952	Y194H	probably damaging	Het

Other mutations in Traf3ip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01941:Traf3ip2	APN	10	39634660	missense	probably benign
IGL02097:Traf3ip2	APN	10	39654479	missense	probably damaging	0.99
IGL02530:Traf3ip2	APN	10	39646906	missense	possibly damaging	0.80
IGL02957:Traf3ip2	APN	10	39654410	missense	probably damaging	1.00
IGL03034:Traf3ip2	APN	10	39626219	missense	probably damaging	1.00
IGL03123:Traf3ip2	APN	10	39639222	missense	possibly damaging	0.87
IGL03386:Traf3ip2	APN	10	39645708	missense	probably benign	0.03
R0328:Traf3ip2	UTSW	10	39634673	missense	probably damaging	0.96
R1282:Traf3ip2	UTSW	10	39626405	missense	probably damaging	1.00
R2975:Traf3ip2	UTSW	10	39626540	missense	probably benign	0.00
R4575:Traf3ip2	UTSW	10	39634654	missense	probably damaging	0.97
R4576:Traf3ip2	UTSW	10	39634654	missense	probably damaging	0.97
R4578:Traf3ip2	UTSW	10	39634654	missense	probably damaging	0.97
R4670:Traf3ip2	UTSW	10	39639260	missense	possibly damaging	0.76
R4680:Traf3ip2	UTSW	10	39639260	missense	possibly damaging	0.76
R4681:Traf3ip2	UTSW	10	39639260	missense	possibly damaging	0.76
R4710:Traf3ip2	UTSW	10	39639260	missense	possibly damaging	0.76
R4742:Traf3ip2	UTSW	10	39639260	missense	possibly damaging	0.76
R4760:Traf3ip2	UTSW	10	39645739	missense	probably damaging	1.00
R4934:Traf3ip2	UTSW	10	39626100	missense	probably damaging	1.00
R5079:Traf3ip2	UTSW	10	39626477	missense	probably damaging	1.00
R5959:Traf3ip2	UTSW	10	39641341	missense	probably benign	0.13
R6421:Traf3ip2	UTSW	10	39639404	splice site	probably null
R6462:Traf3ip2	UTSW	10	39639247	missense	probably benign	0.00
R7156:Traf3ip2	UTSW	10	39626177	missense	possibly damaging	0.61
R7840:Traf3ip2	UTSW	10	39626455	missense	probably damaging	0.99
R9489:Traf3ip2	UTSW	10	39645776	missense	probably benign	0.08
R9605:Traf3ip2	UTSW	10	39645776	missense	probably benign	0.08
X0020:Traf3ip2	UTSW	10	39654519	missense	probably damaging	0.97
Z1177:Traf3ip2	UTSW	10	39626533	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCACAATGCTGTCACACTACTG -3'
(R):5'- CCAAGTTCAGGGTGCCTTCTAAAG -3'

Sequencing Primer
(F):5'- TGTTAATTTAAACCACATCCTGAACC -3'
(R):5'- GGTGCCTTCTAAAGAAACTGGCTTC -3'

Posted On

2014-07-14