Incidental Mutation 'R1913:Hcn2'
ID214584
Institutional Source Beutler Lab
Gene Symbol Hcn2
Ensembl Gene ENSMUSG00000020331
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 2
SynonymsHAC1, trls
MMRRC Submission 039931-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1913 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79716634-79736108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79730943 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 485 (M485V)
Ref Sequence ENSEMBL: ENSMUSP00000097113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020581] [ENSMUST00000099513]
Predicted Effect probably benign
Transcript: ENSMUST00000020581
AA Change: M485V

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020581
Gene: ENSMUSG00000020331
AA Change: M485V

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 140 183 5e-23 PFAM
Pfam:Ion_trans 184 447 3.3e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099513
AA Change: M485V

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097113
Gene: ENSMUSG00000020331
AA Change: M485V

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 139 215 2.6e-47 PFAM
Pfam:Ion_trans 219 435 1.5e-20 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a hyperpolarization-activated cation channel involved in the generation of native pacemaker activity in the heart and in the brain. The encoded protein is activated by cAMP and can produce a fast, large current. Defects in this gene were noted as a possible cause of some forms of epilepsy. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for mutant alleles exhibit decreased body weight, behavioral/neurological abnormalities, and tremors or absence seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T G 5: 9,266,275 L2R probably damaging Het
Abca16 A T 7: 120,541,240 I1588F probably benign Het
Abcc2 A T 19: 43,807,244 T480S probably benign Het
Acnat1 A G 4: 49,447,498 I361T probably damaging Het
Adamts10 A T 17: 33,549,555 H869L probably benign Het
AF366264 T A 8: 13,837,143 Q316L probably benign Het
Agpat5 T C 8: 18,879,613 C253R probably benign Het
Agtrap T A 4: 148,083,977 H15L probably damaging Het
Ahnak T A 19: 9,007,922 V2190E probably damaging Het
Alx4 A G 2: 93,675,387 E278G probably damaging Het
Amz2 T C 11: 109,428,871 S28P probably damaging Het
Atr T A 9: 95,866,733 Y444N probably benign Het
Brdt T C 5: 107,348,613 I197T probably benign Het
Ccser1 G T 6: 62,379,894 S772I probably damaging Het
Cdh16 T C 8: 104,616,468 H657R probably benign Het
Ceacam5 A T 7: 17,759,577 K842* probably null Het
Cep120 G A 18: 53,723,286 T353I probably benign Het
Chrnb1 T C 11: 69,793,584 N164S possibly damaging Het
Cse1l T C 2: 166,922,191 F123L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dcx G C X: 143,923,103 L231V probably damaging Het
Dnah12 T C 14: 26,792,264 probably null Het
Dnah2 A T 11: 69,464,930 M2227K probably damaging Het
Dnajc30 G A 5: 135,064,332 A28T probably benign Het
Dnm1l T C 16: 16,329,966 T306A probably benign Het
Enpp3 C A 10: 24,776,771 E763* probably null Het
Esyt3 T C 9: 99,320,311 S516G probably benign Het
Exoc3 T C 13: 74,182,316 Q498R probably damaging Het
Fbn2 T A 18: 58,061,742 N1449I probably damaging Het
Fgb T C 3: 83,044,980 D194G probably benign Het
Fgd3 T C 13: 49,263,848 D713G possibly damaging Het
Foxb1 T A 9: 69,760,101 Y49F possibly damaging Het
Fpr3 A G 17: 17,971,408 I314V probably damaging Het
Gfod1 A T 13: 43,303,445 I18N probably damaging Het
Gm11492 T C 11: 87,567,012 S71P probably benign Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm7534 A G 4: 134,192,675 probably null Het
Gpr89 A G 3: 96,875,633 F334L possibly damaging Het
Gucy2d G T 7: 98,443,847 V144F probably benign Het
H2-Bl T A 17: 36,081,016 K237M probably damaging Het
H2-M10.5 C A 17: 36,774,768 P273H probably damaging Het
Helz2 G T 2: 181,233,750 S1650R probably damaging Het
Ifnar2 T C 16: 91,404,170 V433A probably benign Het
Igsf21 T A 4: 140,107,312 Y83F probably benign Het
Kcnk18 A G 19: 59,235,058 I212V possibly damaging Het
Kcns2 T C 15: 34,839,709 I406T probably damaging Het
Krt42 C T 11: 100,267,249 V166M possibly damaging Het
Lama3 T C 18: 12,495,279 M1476T probably benign Het
Lcor A G 19: 41,558,474 R166G probably benign Het
Mapt C T 11: 104,328,075 P354L probably damaging Het
Mep1b A T 18: 21,093,229 I383F probably benign Het
Mpzl1 C A 1: 165,601,805 C222F probably benign Het
Mug2 T C 6: 122,070,870 L780P probably damaging Het
Naip2 C T 13: 100,152,157 probably null Het
Ndufab1 T C 7: 122,096,691 D41G probably benign Het
Ntn1 A G 11: 68,213,185 C546R probably damaging Het
Olfr448 T A 6: 42,896,753 F101I probably damaging Het
Pakap A G 4: 57,892,963 E880G probably damaging Het
Pde6b A G 5: 108,427,190 E639G probably benign Het
Phf10 T C 17: 14,956,809 T83A probably benign Het
Phkb T A 8: 85,901,920 I186N possibly damaging Het
Pkhd1 A G 1: 20,566,756 probably null Het
Plxnd1 C A 6: 115,978,017 A595S possibly damaging Het
Ppara T A 15: 85,801,099 H416Q probably damaging Het
Prodh T A 16: 18,081,027 D188V probably damaging Het
Psmd14 A T 2: 61,785,456 K223M possibly damaging Het
Ptpn5 A G 7: 47,078,868 M528T possibly damaging Het
Rassf9 G A 10: 102,544,939 E59K probably benign Het
Rnf2 A T 1: 151,476,185 L140H probably damaging Het
Scai A G 2: 39,080,081 F557S probably damaging Het
Sdk2 A G 11: 113,856,726 S653P possibly damaging Het
Sec24c A G 14: 20,689,111 D534G probably benign Het
Serinc1 A G 10: 57,519,465 V375A probably benign Het
Serpinb9f C T 13: 33,325,846 A7V probably damaging Het
Smco1 T C 16: 32,273,882 S124P probably damaging Het
Smim23 C A 11: 32,824,441 C26F possibly damaging Het
Sppl2c T A 11: 104,187,889 M505K probably benign Het
Sprr1b C A 3: 92,437,468 V34F possibly damaging Het
Sun1 G A 5: 139,235,732 probably null Het
Supt16 A G 14: 52,178,135 L381P possibly damaging Het
Syne2 A G 12: 75,899,246 D364G possibly damaging Het
Tax1bp1 G T 6: 52,765,952 V775F probably damaging Het
Tial1 T A 7: 128,444,659 I231F probably damaging Het
Tiam1 C A 16: 89,798,694 V1300L probably damaging Het
Tmem132e A G 11: 82,443,417 T585A probably damaging Het
Tnni3k C T 3: 154,979,199 A165T probably benign Het
Tomm40 A T 7: 19,710,961 I165N probably damaging Het
Tomt T C 7: 101,901,247 E104G probably damaging Het
Topaz1 T C 9: 122,767,013 S950P possibly damaging Het
Traf3ip2 C G 10: 39,625,940 P28R probably benign Het
Trim24 C T 6: 37,957,815 P822S probably damaging Het
Upf3a T G 8: 13,792,108 Y175D probably damaging Het
Vars2 G A 17: 35,666,922 P69S probably benign Het
Veph1 T C 3: 66,244,555 Y151C probably damaging Het
Vmn2r11 T A 5: 109,054,788 D141V probably benign Het
Vwa5b1 G A 4: 138,592,020 Q442* probably null Het
Wdr17 T A 8: 54,687,726 D197V probably damaging Het
Wdr70 G T 15: 7,884,410 T586N possibly damaging Het
Wfdc18 G A 11: 83,709,928 G52R probably benign Het
Zc3h6 T C 2: 129,016,620 I857T probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,412,524 probably benign Het
Zfp647 C T 15: 76,911,951 V170I probably benign Het
Zfp871 T C 17: 32,775,917 N76D possibly damaging Het
Zwilch A G 9: 64,160,952 Y194H probably damaging Het
Other mutations in Hcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Hcn2 APN 10 79733803 nonsense probably null
IGL01339:Hcn2 APN 10 79729068 missense probably damaging 1.00
IGL02183:Hcn2 APN 10 79724813 critical splice donor site probably null
asombrarse UTSW 10 79724611 missense probably damaging 1.00
curveball UTSW 10 79724786 missense probably damaging 1.00
curveball2 UTSW 10 79733773 nonsense probably null
mire UTSW 10 79729113 critical splice donor site probably null
R0269:Hcn2 UTSW 10 79734241 unclassified probably benign
R0671:Hcn2 UTSW 10 79734232 splice site probably null
R1879:Hcn2 UTSW 10 79726189 missense probably benign 0.03
R4051:Hcn2 UTSW 10 79733687 unclassified probably null
R4052:Hcn2 UTSW 10 79733687 unclassified probably null
R4328:Hcn2 UTSW 10 79724611 missense probably damaging 1.00
R4507:Hcn2 UTSW 10 79724786 missense probably damaging 1.00
R4518:Hcn2 UTSW 10 79724702 missense probably benign 0.17
R4578:Hcn2 UTSW 10 79724448 synonymous probably null
R5334:Hcn2 UTSW 10 79726291 missense probably damaging 0.99
R5788:Hcn2 UTSW 10 79717111 missense possibly damaging 0.48
R6131:Hcn2 UTSW 10 79733908 missense probably damaging 1.00
R6457:Hcn2 UTSW 10 79733773 nonsense probably null
R6547:Hcn2 UTSW 10 79717152 missense probably benign 0.29
R6851:Hcn2 UTSW 10 79729113 critical splice donor site probably null
R7276:Hcn2 UTSW 10 79729100 missense possibly damaging 0.95
R7706:Hcn2 UTSW 10 79734183 missense possibly damaging 0.78
X0024:Hcn2 UTSW 10 79734120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGCTGTGTAAAGTGTG -3'
(R):5'- GCACCTACTGCTGGGTTTACAC -3'

Sequencing Primer
(F):5'- CAGGCTGTGTAAAGTGTGTGTCTC -3'
(R):5'- TTTACACCAGCTGGCCAG -3'
Posted On2014-07-14