Incidental Mutation 'R1913:Septin4'
ID 214593
Institutional Source Beutler Lab
Gene Symbol Septin4
Ensembl Gene ENSMUSG00000020486
Gene Name septin 4
Synonyms Gm11492, ARTS, septin H5, cell division control-related protein 2b, Sept4, Bh5, Pnutl2
MMRRC Submission 039931-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.768) question?
Stock # R1913 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 87457515-87481365 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87457838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 71 (S71P)
Ref Sequence ENSEMBL: ENSMUSP00000053087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060360] [ENSMUST00000122945]
AlphaFold P28661
Q5ND19
Predicted Effect probably benign
Transcript: ENSMUST00000060360
AA Change: S71P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053087
Gene: ENSMUSG00000090107
AA Change: S71P

DomainStartEndE-ValueType
Pfam:DUF4655 13 369 1.7e-99 PFAM
Pfam:DUF4655 366 509 2.7e-68 PFAM
low complexity region 511 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122945
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,140,463 (GRCm39) I1588F probably benign Het
Abcc2 A T 19: 43,795,683 (GRCm39) T480S probably benign Het
Acnat1 A G 4: 49,447,498 (GRCm39) I361T probably damaging Het
Adamts10 A T 17: 33,768,529 (GRCm39) H869L probably benign Het
Agpat5 T C 8: 18,929,629 (GRCm39) C253R probably benign Het
Agtrap T A 4: 148,168,434 (GRCm39) H15L probably damaging Het
Ahnak T A 19: 8,985,286 (GRCm39) V2190E probably damaging Het
Alx4 A G 2: 93,505,732 (GRCm39) E278G probably damaging Het
Amz2 T C 11: 109,319,697 (GRCm39) S28P probably damaging Het
Atr T A 9: 95,748,786 (GRCm39) Y444N probably benign Het
Brdt T C 5: 107,496,479 (GRCm39) I197T probably benign Het
Ccser1 G T 6: 62,356,878 (GRCm39) S772I probably damaging Het
Cdh16 T C 8: 105,343,100 (GRCm39) H657R probably benign Het
Ceacam5 A T 7: 17,493,502 (GRCm39) K842* probably null Het
Cep120 G A 18: 53,856,358 (GRCm39) T353I probably benign Het
Chrnb1 T C 11: 69,684,410 (GRCm39) N164S possibly damaging Het
Cse1l T C 2: 166,764,111 (GRCm39) F123L probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dcx G C X: 142,706,099 (GRCm39) L231V probably damaging Het
Dnah12 T C 14: 26,514,221 (GRCm39) probably null Het
Dnah2 A T 11: 69,355,756 (GRCm39) M2227K probably damaging Het
Dnajc30 G A 5: 135,093,186 (GRCm39) A28T probably benign Het
Dnm1l T C 16: 16,147,830 (GRCm39) T306A probably benign Het
Elapor2 T G 5: 9,316,275 (GRCm39) L2R probably damaging Het
Enpp3 C A 10: 24,652,669 (GRCm39) E763* probably null Het
Esyt3 T C 9: 99,202,364 (GRCm39) S516G probably benign Het
Exoc3 T C 13: 74,330,435 (GRCm39) Q498R probably damaging Het
Fbn2 T A 18: 58,194,814 (GRCm39) N1449I probably damaging Het
Fgb T C 3: 82,952,287 (GRCm39) D194G probably benign Het
Fgd3 T C 13: 49,417,324 (GRCm39) D713G possibly damaging Het
Foxb1 T A 9: 69,667,383 (GRCm39) Y49F possibly damaging Het
Fpr3 A G 17: 18,191,670 (GRCm39) I314V probably damaging Het
Gfod1 A T 13: 43,456,921 (GRCm39) I18N probably damaging Het
Gm5407 T C 16: 49,117,283 (GRCm39) noncoding transcript Het
Gpr89 A G 3: 96,782,949 (GRCm39) F334L possibly damaging Het
Gucy2d G T 7: 98,093,054 (GRCm39) V144F probably benign Het
H2-M10.5 C A 17: 37,085,660 (GRCm39) P273H probably damaging Het
H2-T13 T A 17: 36,391,908 (GRCm39) K237M probably damaging Het
Hcn2 A G 10: 79,566,777 (GRCm39) M485V probably benign Het
Helz2 G T 2: 180,875,543 (GRCm39) S1650R probably damaging Het
Ifnar2 T C 16: 91,201,058 (GRCm39) V433A probably benign Het
Igsf21 T A 4: 139,834,623 (GRCm39) Y83F probably benign Het
Kcnk18 A G 19: 59,223,490 (GRCm39) I212V possibly damaging Het
Kcns2 T C 15: 34,839,855 (GRCm39) I406T probably damaging Het
Krt42 C T 11: 100,158,075 (GRCm39) V166M possibly damaging Het
Lama3 T C 18: 12,628,336 (GRCm39) M1476T probably benign Het
Lcor A G 19: 41,546,913 (GRCm39) R166G probably benign Het
Mapt C T 11: 104,218,901 (GRCm39) P354L probably damaging Het
Mep1b A T 18: 21,226,286 (GRCm39) I383F probably benign Het
Mpzl1 C A 1: 165,429,374 (GRCm39) C222F probably benign Het
Mug2 T C 6: 122,047,829 (GRCm39) L780P probably damaging Het
Naip2 C T 13: 100,288,665 (GRCm39) probably null Het
Ndufab1 T C 7: 121,695,914 (GRCm39) D41G probably benign Het
Ntn1 A G 11: 68,104,011 (GRCm39) C546R probably damaging Het
Or2a5 T A 6: 42,873,687 (GRCm39) F101I probably damaging Het
Pakap A G 4: 57,892,963 (GRCm39) E880G probably damaging Het
Pde6b A G 5: 108,575,056 (GRCm39) E639G probably benign Het
Phf10 T C 17: 15,177,071 (GRCm39) T83A probably benign Het
Phkb T A 8: 86,628,549 (GRCm39) I186N possibly damaging Het
Pkhd1 A G 1: 20,636,980 (GRCm39) probably null Het
Plxnd1 C A 6: 115,954,978 (GRCm39) A595S possibly damaging Het
Ppara T A 15: 85,685,300 (GRCm39) H416Q probably damaging Het
Prodh T A 16: 17,898,891 (GRCm39) D188V probably damaging Het
Psmd14 A T 2: 61,615,800 (GRCm39) K223M possibly damaging Het
Ptpn5 A G 7: 46,728,616 (GRCm39) M528T possibly damaging Het
Rassf9 G A 10: 102,380,800 (GRCm39) E59K probably benign Het
Rnf2 A T 1: 151,351,936 (GRCm39) L140H probably damaging Het
Scai A G 2: 38,970,093 (GRCm39) F557S probably damaging Het
Sdk2 A G 11: 113,747,552 (GRCm39) S653P possibly damaging Het
Sec24c A G 14: 20,739,179 (GRCm39) D534G probably benign Het
Semp2l2a T A 8: 13,887,143 (GRCm39) Q316L probably benign Het
Serinc1 A G 10: 57,395,561 (GRCm39) V375A probably benign Het
Serpinb9f C T 13: 33,509,829 (GRCm39) A7V probably damaging Het
Smco1 T C 16: 32,092,700 (GRCm39) S124P probably damaging Het
Smim23 C A 11: 32,774,441 (GRCm39) C26F possibly damaging Het
Sppl2c T A 11: 104,078,715 (GRCm39) M505K probably benign Het
Sprr1b C A 3: 92,344,775 (GRCm39) V34F possibly damaging Het
Sun1 G A 5: 139,221,487 (GRCm39) probably null Het
Supt16 A G 14: 52,415,592 (GRCm39) L381P possibly damaging Het
Syne2 A G 12: 75,946,020 (GRCm39) D364G possibly damaging Het
Tax1bp1 G T 6: 52,742,937 (GRCm39) V775F probably damaging Het
Tial1 T A 7: 128,046,383 (GRCm39) I231F probably damaging Het
Tiam1 C A 16: 89,595,582 (GRCm39) V1300L probably damaging Het
Tmem132e A G 11: 82,334,243 (GRCm39) T585A probably damaging Het
Tnni3k C T 3: 154,684,836 (GRCm39) A165T probably benign Het
Tomm40 A T 7: 19,444,886 (GRCm39) I165N probably damaging Het
Tomt T C 7: 101,550,454 (GRCm39) E104G probably damaging Het
Topaz1 T C 9: 122,596,078 (GRCm39) S950P possibly damaging Het
Traf3ip2 C G 10: 39,501,936 (GRCm39) P28R probably benign Het
Trim24 C T 6: 37,934,750 (GRCm39) P822S probably damaging Het
Upf3a T G 8: 13,842,108 (GRCm39) Y175D probably damaging Het
Vars2 G A 17: 35,977,814 (GRCm39) P69S probably benign Het
Veph1 T C 3: 66,151,976 (GRCm39) Y151C probably damaging Het
Vmn2r11 T A 5: 109,202,654 (GRCm39) D141V probably benign Het
Vwa5b1 G A 4: 138,319,331 (GRCm39) Q442* probably null Het
Wdr17 T A 8: 55,140,761 (GRCm39) D197V probably damaging Het
Wdr70 G T 15: 7,913,891 (GRCm39) T586N possibly damaging Het
Wfdc18 G A 11: 83,600,754 (GRCm39) G52R probably benign Het
Zc3h6 T C 2: 128,858,540 (GRCm39) I857T probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,723,440 (GRCm39) probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,723,450 (GRCm39) probably benign Het
Zfp647 C T 15: 76,796,151 (GRCm39) V170I probably benign Het
Zfp871 T C 17: 32,994,891 (GRCm39) N76D possibly damaging Het
Zpld2 A G 4: 133,919,986 (GRCm39) probably null Het
Zwilch A G 9: 64,068,234 (GRCm39) Y194H probably damaging Het
Other mutations in Septin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Septin4 APN 11 87,480,599 (GRCm39) missense probably damaging 1.00
IGL00963:Septin4 APN 11 87,474,199 (GRCm39) missense possibly damaging 0.89
IGL01803:Septin4 APN 11 87,459,075 (GRCm39) missense probably benign 0.07
IGL01993:Septin4 APN 11 87,458,555 (GRCm39) missense possibly damaging 0.85
IGL02566:Septin4 APN 11 87,458,468 (GRCm39) missense probably benign 0.00
IGL03087:Septin4 APN 11 87,476,071 (GRCm39) splice site probably benign
IGL03213:Septin4 APN 11 87,458,184 (GRCm39) splice site probably null
IGL03268:Septin4 APN 11 87,480,529 (GRCm39) missense probably damaging 0.99
IGL03388:Septin4 APN 11 87,459,042 (GRCm39) nonsense probably null
R0050:Septin4 UTSW 11 87,458,172 (GRCm39) missense probably damaging 1.00
R0077:Septin4 UTSW 11 87,472,022 (GRCm39) missense probably benign
R1479:Septin4 UTSW 11 87,458,244 (GRCm39) missense probably damaging 1.00
R1729:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1730:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1739:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1762:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1783:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1784:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1785:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1851:Septin4 UTSW 11 87,459,741 (GRCm39) missense probably damaging 1.00
R1862:Septin4 UTSW 11 87,458,061 (GRCm39) missense possibly damaging 0.48
R1957:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R2131:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2133:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2140:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2141:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2252:Septin4 UTSW 11 87,480,637 (GRCm39) missense possibly damaging 0.75
R3149:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3176:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3276:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3696:Septin4 UTSW 11 87,476,060 (GRCm39) missense possibly damaging 0.48
R4018:Septin4 UTSW 11 87,475,947 (GRCm39) missense probably damaging 1.00
R4021:Septin4 UTSW 11 87,458,106 (GRCm39) missense probably damaging 1.00
R4117:Septin4 UTSW 11 87,459,108 (GRCm39) missense probably damaging 1.00
R4193:Septin4 UTSW 11 87,474,142 (GRCm39) critical splice acceptor site probably null
R4196:Septin4 UTSW 11 87,479,598 (GRCm39) missense probably damaging 0.96
R4332:Septin4 UTSW 11 87,458,730 (GRCm39) missense possibly damaging 0.95
R4515:Septin4 UTSW 11 87,458,883 (GRCm39) missense probably benign
R4663:Septin4 UTSW 11 87,458,429 (GRCm39) missense probably damaging 0.98
R4952:Septin4 UTSW 11 87,458,598 (GRCm39) missense probably benign 0.00
R5012:Septin4 UTSW 11 87,475,230 (GRCm39) missense possibly damaging 0.78
R5015:Septin4 UTSW 11 87,458,043 (GRCm39) missense possibly damaging 0.95
R5149:Septin4 UTSW 11 87,480,071 (GRCm39) missense probably damaging 1.00
R5176:Septin4 UTSW 11 87,458,358 (GRCm39) missense probably benign 0.02
R5711:Septin4 UTSW 11 87,458,723 (GRCm39) missense probably benign 0.07
R5891:Septin4 UTSW 11 87,479,750 (GRCm39) unclassified probably benign
R6090:Septin4 UTSW 11 87,480,343 (GRCm39) missense possibly damaging 0.48
R6145:Septin4 UTSW 11 87,476,072 (GRCm39) splice site probably null
R6257:Septin4 UTSW 11 87,481,175 (GRCm39) missense probably benign 0.07
R6305:Septin4 UTSW 11 87,458,145 (GRCm39) missense probably benign 0.00
R6704:Septin4 UTSW 11 87,479,856 (GRCm39) missense probably damaging 1.00
R7064:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R7090:Septin4 UTSW 11 87,475,264 (GRCm39) missense probably damaging 1.00
R7784:Septin4 UTSW 11 87,469,834 (GRCm39) missense probably benign
R7790:Septin4 UTSW 11 87,480,065 (GRCm39) missense probably damaging 1.00
R8320:Septin4 UTSW 11 87,480,560 (GRCm39) missense possibly damaging 0.68
R9289:Septin4 UTSW 11 87,459,792 (GRCm39) nonsense probably null
R9613:Septin4 UTSW 11 87,469,823 (GRCm39) missense possibly damaging 0.53
T0970:Septin4 UTSW 11 87,458,558 (GRCm39) missense probably damaging 0.98
Z1177:Septin4 UTSW 11 87,458,748 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCACAGTCTATCAGGTGTAC -3'
(R):5'- ACATTCCGATGCACTCCTGC -3'

Sequencing Primer
(F):5'- ACAGTCTATCAGGTGTACAAGAC -3'
(R):5'- GGAGGACATTGTCTGAATTGAC -3'
Posted On 2014-07-14