Incidental Mutation 'R1913:Naip2'
ID214604
Institutional Source Beutler Lab
Gene Symbol Naip2
Ensembl Gene ENSMUSG00000078945
Gene NameNLR family, apoptosis inhibitory protein 2
SynonymsBirc1b, Naip2, Naip-rs6
MMRRC Submission 039931-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1913 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100144063-100202092 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to T at 100152157 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000067975] [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000117913] [ENSMUST00000117913] [ENSMUST00000167986] [ENSMUST00000167986] [ENSMUST00000167986]
Predicted Effect probably null
Transcript: ENSMUST00000067975
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000067975
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000067975
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117913
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117913
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117913
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167986
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167986
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167986
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221573
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T G 5: 9,266,275 L2R probably damaging Het
Abca16 A T 7: 120,541,240 I1588F probably benign Het
Abcc2 A T 19: 43,807,244 T480S probably benign Het
Acnat1 A G 4: 49,447,498 I361T probably damaging Het
Adamts10 A T 17: 33,549,555 H869L probably benign Het
AF366264 T A 8: 13,837,143 Q316L probably benign Het
Agpat5 T C 8: 18,879,613 C253R probably benign Het
Agtrap T A 4: 148,083,977 H15L probably damaging Het
Ahnak T A 19: 9,007,922 V2190E probably damaging Het
Alx4 A G 2: 93,675,387 E278G probably damaging Het
Amz2 T C 11: 109,428,871 S28P probably damaging Het
Atr T A 9: 95,866,733 Y444N probably benign Het
Brdt T C 5: 107,348,613 I197T probably benign Het
Ccser1 G T 6: 62,379,894 S772I probably damaging Het
Cdh16 T C 8: 104,616,468 H657R probably benign Het
Ceacam5 A T 7: 17,759,577 K842* probably null Het
Cep120 G A 18: 53,723,286 T353I probably benign Het
Chrnb1 T C 11: 69,793,584 N164S possibly damaging Het
Cse1l T C 2: 166,922,191 F123L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dcx G C X: 143,923,103 L231V probably damaging Het
Dnah12 T C 14: 26,792,264 probably null Het
Dnah2 A T 11: 69,464,930 M2227K probably damaging Het
Dnajc30 G A 5: 135,064,332 A28T probably benign Het
Dnm1l T C 16: 16,329,966 T306A probably benign Het
Enpp3 C A 10: 24,776,771 E763* probably null Het
Esyt3 T C 9: 99,320,311 S516G probably benign Het
Exoc3 T C 13: 74,182,316 Q498R probably damaging Het
Fbn2 T A 18: 58,061,742 N1449I probably damaging Het
Fgb T C 3: 83,044,980 D194G probably benign Het
Fgd3 T C 13: 49,263,848 D713G possibly damaging Het
Foxb1 T A 9: 69,760,101 Y49F possibly damaging Het
Fpr3 A G 17: 17,971,408 I314V probably damaging Het
Gfod1 A T 13: 43,303,445 I18N probably damaging Het
Gm11492 T C 11: 87,567,012 S71P probably benign Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm7534 A G 4: 134,192,675 probably null Het
Gpr89 A G 3: 96,875,633 F334L possibly damaging Het
Gucy2d G T 7: 98,443,847 V144F probably benign Het
H2-Bl T A 17: 36,081,016 K237M probably damaging Het
H2-M10.5 C A 17: 36,774,768 P273H probably damaging Het
Hcn2 A G 10: 79,730,943 M485V probably benign Het
Helz2 G T 2: 181,233,750 S1650R probably damaging Het
Ifnar2 T C 16: 91,404,170 V433A probably benign Het
Igsf21 T A 4: 140,107,312 Y83F probably benign Het
Kcnk18 A G 19: 59,235,058 I212V possibly damaging Het
Kcns2 T C 15: 34,839,709 I406T probably damaging Het
Krt42 C T 11: 100,267,249 V166M possibly damaging Het
Lama3 T C 18: 12,495,279 M1476T probably benign Het
Lcor A G 19: 41,558,474 R166G probably benign Het
Mapt C T 11: 104,328,075 P354L probably damaging Het
Mep1b A T 18: 21,093,229 I383F probably benign Het
Mpzl1 C A 1: 165,601,805 C222F probably benign Het
Mug2 T C 6: 122,070,870 L780P probably damaging Het
Ndufab1 T C 7: 122,096,691 D41G probably benign Het
Ntn1 A G 11: 68,213,185 C546R probably damaging Het
Olfr448 T A 6: 42,896,753 F101I probably damaging Het
Pakap A G 4: 57,892,963 E880G probably damaging Het
Pde6b A G 5: 108,427,190 E639G probably benign Het
Phf10 T C 17: 14,956,809 T83A probably benign Het
Phkb T A 8: 85,901,920 I186N possibly damaging Het
Pkhd1 A G 1: 20,566,756 probably null Het
Plxnd1 C A 6: 115,978,017 A595S possibly damaging Het
Ppara T A 15: 85,801,099 H416Q probably damaging Het
Prodh T A 16: 18,081,027 D188V probably damaging Het
Psmd14 A T 2: 61,785,456 K223M possibly damaging Het
Ptpn5 A G 7: 47,078,868 M528T possibly damaging Het
Rassf9 G A 10: 102,544,939 E59K probably benign Het
Rnf2 A T 1: 151,476,185 L140H probably damaging Het
Scai A G 2: 39,080,081 F557S probably damaging Het
Sdk2 A G 11: 113,856,726 S653P possibly damaging Het
Sec24c A G 14: 20,689,111 D534G probably benign Het
Serinc1 A G 10: 57,519,465 V375A probably benign Het
Serpinb9f C T 13: 33,325,846 A7V probably damaging Het
Smco1 T C 16: 32,273,882 S124P probably damaging Het
Smim23 C A 11: 32,824,441 C26F possibly damaging Het
Sppl2c T A 11: 104,187,889 M505K probably benign Het
Sprr1b C A 3: 92,437,468 V34F possibly damaging Het
Sun1 G A 5: 139,235,732 probably null Het
Supt16 A G 14: 52,178,135 L381P possibly damaging Het
Syne2 A G 12: 75,899,246 D364G possibly damaging Het
Tax1bp1 G T 6: 52,765,952 V775F probably damaging Het
Tial1 T A 7: 128,444,659 I231F probably damaging Het
Tiam1 C A 16: 89,798,694 V1300L probably damaging Het
Tmem132e A G 11: 82,443,417 T585A probably damaging Het
Tnni3k C T 3: 154,979,199 A165T probably benign Het
Tomm40 A T 7: 19,710,961 I165N probably damaging Het
Tomt T C 7: 101,901,247 E104G probably damaging Het
Topaz1 T C 9: 122,767,013 S950P possibly damaging Het
Traf3ip2 C G 10: 39,625,940 P28R probably benign Het
Trim24 C T 6: 37,957,815 P822S probably damaging Het
Upf3a T G 8: 13,792,108 Y175D probably damaging Het
Vars2 G A 17: 35,666,922 P69S probably benign Het
Veph1 T C 3: 66,244,555 Y151C probably damaging Het
Vmn2r11 T A 5: 109,054,788 D141V probably benign Het
Vwa5b1 G A 4: 138,592,020 Q442* probably null Het
Wdr17 T A 8: 54,687,726 D197V probably damaging Het
Wdr70 G T 15: 7,884,410 T586N possibly damaging Het
Wfdc18 G A 11: 83,709,928 G52R probably benign Het
Zc3h6 T C 2: 129,016,620 I857T probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,412,524 probably benign Het
Zfp647 C T 15: 76,911,951 V170I probably benign Het
Zfp871 T C 17: 32,775,917 N76D possibly damaging Het
Zwilch A G 9: 64,160,952 Y194H probably damaging Het
Other mutations in Naip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Naip2 APN 13 100154887 missense probably benign 0.00
IGL00676:Naip2 APN 13 100152632 missense probably damaging 1.00
IGL00870:Naip2 APN 13 100152060 splice site probably benign
IGL00908:Naip2 APN 13 100160649 missense probably benign 0.01
IGL00916:Naip2 APN 13 100161431 missense probably damaging 0.97
IGL00949:Naip2 APN 13 100161591 missense probably damaging 1.00
IGL01010:Naip2 APN 13 100154938 missense probably damaging 0.99
IGL01642:Naip2 APN 13 100160937 missense probably damaging 0.97
IGL01884:Naip2 APN 13 100188821 splice site probably benign
IGL01917:Naip2 APN 13 100162083 missense probably benign 0.00
IGL02015:Naip2 APN 13 100161607 missense possibly damaging 0.57
IGL02315:Naip2 APN 13 100161236 missense probably damaging 1.00
IGL02328:Naip2 APN 13 100161369 missense probably damaging 1.00
IGL02735:Naip2 APN 13 100160214 missense probably damaging 0.99
IGL02738:Naip2 APN 13 100189177 missense probably benign 0.01
IGL02887:Naip2 APN 13 100161512 missense possibly damaging 0.90
IGL02894:Naip2 APN 13 100160997 missense probably damaging 1.00
IGL02894:Naip2 APN 13 100183789 missense probably benign
IGL02974:Naip2 APN 13 100161678 missense probably damaging 1.00
IGL03024:Naip2 APN 13 100189354 missense possibly damaging 0.50
IGL03056:Naip2 APN 13 100162287 missense possibly damaging 0.90
IGL03281:Naip2 APN 13 100161620 missense probably damaging 0.99
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0132:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0310:Naip2 UTSW 13 100148842 missense probably damaging 1.00
R0367:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0368:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0422:Naip2 UTSW 13 100161113 missense probably benign 0.10
R0441:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0445:Naip2 UTSW 13 100161887 missense possibly damaging 0.91
R0446:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0464:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0466:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0467:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0486:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0533:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0853:Naip2 UTSW 13 100161854 missense probably benign
R0853:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0855:Naip2 UTSW 13 100161854 missense probably benign
R0855:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0904:Naip2 UTSW 13 100161854 missense probably benign
R0904:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0906:Naip2 UTSW 13 100161854 missense probably benign
R0906:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0908:Naip2 UTSW 13 100161854 missense probably benign
R0908:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0959:Naip2 UTSW 13 100154878 missense probably benign 0.01
R0959:Naip2 UTSW 13 100154911 missense probably benign 0.03
R0962:Naip2 UTSW 13 100179385 missense probably damaging 1.00
R1024:Naip2 UTSW 13 100161854 missense probably benign
R1024:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1186:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1186:Naip2 UTSW 13 100162037 frame shift probably null
R1217:Naip2 UTSW 13 100161854 missense probably benign
R1217:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1340:Naip2 UTSW 13 100189122 missense possibly damaging 0.80
R1342:Naip2 UTSW 13 100161854 missense probably benign
R1342:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1404:Naip2 UTSW 13 100161854 missense probably benign
R1423:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1423:Naip2 UTSW 13 100154847 intron probably benign
R1423:Naip2 UTSW 13 100154872 missense possibly damaging 0.59
R1423:Naip2 UTSW 13 100154878 missense probably benign 0.01
R1426:Naip2 UTSW 13 100161854 missense probably benign
R1426:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1472:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155029 intron probably benign
R1576:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1576:Naip2 UTSW 13 100155029 intron probably benign
R1599:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1640:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1641:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1642:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1643:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1644:Naip2 UTSW 13 100182929 missense possibly damaging 0.83
R1681:Naip2 UTSW 13 100161854 missense probably benign
R1681:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1891:Naip2 UTSW 13 100154887 missense probably benign 0.00
R1937:Naip2 UTSW 13 100161854 missense probably benign
R1937:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1993:Naip2 UTSW 13 100162007 missense probably benign 0.03
R2001:Naip2 UTSW 13 100144588 missense probably damaging 1.00
R2055:Naip2 UTSW 13 100179372 missense probably benign 0.07
R2198:Naip2 UTSW 13 100152592 missense probably damaging 1.00
R2906:Naip2 UTSW 13 100161996 missense probably damaging 1.00
R2931:Naip2 UTSW 13 100155021 missense probably benign 0.00
R3014:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3016:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3037:Naip2 UTSW 13 100154949 missense probably benign 0.08
R3414:Naip2 UTSW 13 100189263 nonsense probably null
R3437:Naip2 UTSW 13 100154911 missense probably benign 0.03
R3713:Naip2 UTSW 13 100161902 missense probably damaging 1.00
R3806:Naip2 UTSW 13 100152634 missense possibly damaging 0.92
R3847:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3847:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3891:Naip2 UTSW 13 100161098 missense probably damaging 0.99
R4419:Naip2 UTSW 13 100160625 missense probably benign 0.03
R4456:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4458:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4689:Naip2 UTSW 13 100148812 missense probably damaging 1.00
R4797:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R4852:Naip2 UTSW 13 100161536 missense probably benign
R4922:Naip2 UTSW 13 100154960 missense probably benign
R5135:Naip2 UTSW 13 100179440 missense probably damaging 0.98
R5185:Naip2 UTSW 13 100189351 missense probably damaging 1.00
R5265:Naip2 UTSW 13 100152560 missense probably damaging 1.00
R5451:Naip2 UTSW 13 100188860 missense probably benign 0.12
R5521:Naip2 UTSW 13 100154914 missense probably damaging 1.00
R5737:Naip2 UTSW 13 100161854 missense probably benign 0.38
R6244:Naip2 UTSW 13 100152137 missense probably damaging 1.00
R6478:Naip2 UTSW 13 100162041 missense probably benign
R6480:Naip2 UTSW 13 100162041 missense probably benign
R6481:Naip2 UTSW 13 100162041 missense probably benign
R6490:Naip2 UTSW 13 100160685 missense probably benign
R6653:Naip2 UTSW 13 100152136 missense probably benign 0.00
R6653:Naip2 UTSW 13 100161844 missense probably benign
R6768:Naip2 UTSW 13 100178324 nonsense probably null
R6791:Naip2 UTSW 13 100154960 missense probably benign
R6793:Naip2 UTSW 13 100154960 missense probably benign
R6890:Naip2 UTSW 13 100162041 missense probably benign
R7036:Naip2 UTSW 13 100155021 missense probably benign 0.00
R7213:Naip2 UTSW 13 100187483 missense probably damaging 1.00
R7342:Naip2 UTSW 13 100189356 missense probably benign 0.09
R7445:Naip2 UTSW 13 100161782 missense probably benign 0.01
R7572:Naip2 UTSW 13 100154960 missense probably benign
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155029 intron probably benign
X0063:Naip2 UTSW 13 100161758 missense probably damaging 1.00
Y5405:Naip2 UTSW 13 100154960 missense probably benign
Z1088:Naip2 UTSW 13 100161909 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATAACTTGCTTTGTTGTAGGTTCC -3'
(R):5'- AACCTGATTCTCAGCGAGGC -3'

Sequencing Primer
(F):5'- CTTTGTTGTAGGTTCCCAGGAG -3'
(R):5'- GATTCTCAGCGAGGCTCTCATAAG -3'
Posted On2014-07-14