Incidental Mutation 'R1913:Supt16'
ID 214607
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name SPT16, facilitates chromatin remodeling subunit
Synonyms Spt16, Fact140, Supt16h, Cdc68
MMRRC Submission 039931-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R1913 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 52397876-52434696 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52415592 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 381 (L381P)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000046709
AA Change: L381P

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: L381P

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,140,463 (GRCm39) I1588F probably benign Het
Abcc2 A T 19: 43,795,683 (GRCm39) T480S probably benign Het
Acnat1 A G 4: 49,447,498 (GRCm39) I361T probably damaging Het
Adamts10 A T 17: 33,768,529 (GRCm39) H869L probably benign Het
Agpat5 T C 8: 18,929,629 (GRCm39) C253R probably benign Het
Agtrap T A 4: 148,168,434 (GRCm39) H15L probably damaging Het
Ahnak T A 19: 8,985,286 (GRCm39) V2190E probably damaging Het
Alx4 A G 2: 93,505,732 (GRCm39) E278G probably damaging Het
Amz2 T C 11: 109,319,697 (GRCm39) S28P probably damaging Het
Atr T A 9: 95,748,786 (GRCm39) Y444N probably benign Het
Brdt T C 5: 107,496,479 (GRCm39) I197T probably benign Het
Ccser1 G T 6: 62,356,878 (GRCm39) S772I probably damaging Het
Cdh16 T C 8: 105,343,100 (GRCm39) H657R probably benign Het
Ceacam5 A T 7: 17,493,502 (GRCm39) K842* probably null Het
Cep120 G A 18: 53,856,358 (GRCm39) T353I probably benign Het
Chrnb1 T C 11: 69,684,410 (GRCm39) N164S possibly damaging Het
Cse1l T C 2: 166,764,111 (GRCm39) F123L probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dcx G C X: 142,706,099 (GRCm39) L231V probably damaging Het
Dnah12 T C 14: 26,514,221 (GRCm39) probably null Het
Dnah2 A T 11: 69,355,756 (GRCm39) M2227K probably damaging Het
Dnajc30 G A 5: 135,093,186 (GRCm39) A28T probably benign Het
Dnm1l T C 16: 16,147,830 (GRCm39) T306A probably benign Het
Elapor2 T G 5: 9,316,275 (GRCm39) L2R probably damaging Het
Enpp3 C A 10: 24,652,669 (GRCm39) E763* probably null Het
Esyt3 T C 9: 99,202,364 (GRCm39) S516G probably benign Het
Exoc3 T C 13: 74,330,435 (GRCm39) Q498R probably damaging Het
Fbn2 T A 18: 58,194,814 (GRCm39) N1449I probably damaging Het
Fgb T C 3: 82,952,287 (GRCm39) D194G probably benign Het
Fgd3 T C 13: 49,417,324 (GRCm39) D713G possibly damaging Het
Foxb1 T A 9: 69,667,383 (GRCm39) Y49F possibly damaging Het
Fpr3 A G 17: 18,191,670 (GRCm39) I314V probably damaging Het
Gfod1 A T 13: 43,456,921 (GRCm39) I18N probably damaging Het
Gm5407 T C 16: 49,117,283 (GRCm39) noncoding transcript Het
Gpr89 A G 3: 96,782,949 (GRCm39) F334L possibly damaging Het
Gucy2d G T 7: 98,093,054 (GRCm39) V144F probably benign Het
H2-M10.5 C A 17: 37,085,660 (GRCm39) P273H probably damaging Het
H2-T13 T A 17: 36,391,908 (GRCm39) K237M probably damaging Het
Hcn2 A G 10: 79,566,777 (GRCm39) M485V probably benign Het
Helz2 G T 2: 180,875,543 (GRCm39) S1650R probably damaging Het
Ifnar2 T C 16: 91,201,058 (GRCm39) V433A probably benign Het
Igsf21 T A 4: 139,834,623 (GRCm39) Y83F probably benign Het
Kcnk18 A G 19: 59,223,490 (GRCm39) I212V possibly damaging Het
Kcns2 T C 15: 34,839,855 (GRCm39) I406T probably damaging Het
Krt42 C T 11: 100,158,075 (GRCm39) V166M possibly damaging Het
Lama3 T C 18: 12,628,336 (GRCm39) M1476T probably benign Het
Lcor A G 19: 41,546,913 (GRCm39) R166G probably benign Het
Mapt C T 11: 104,218,901 (GRCm39) P354L probably damaging Het
Mep1b A T 18: 21,226,286 (GRCm39) I383F probably benign Het
Mpzl1 C A 1: 165,429,374 (GRCm39) C222F probably benign Het
Mug2 T C 6: 122,047,829 (GRCm39) L780P probably damaging Het
Naip2 C T 13: 100,288,665 (GRCm39) probably null Het
Ndufab1 T C 7: 121,695,914 (GRCm39) D41G probably benign Het
Ntn1 A G 11: 68,104,011 (GRCm39) C546R probably damaging Het
Or2a5 T A 6: 42,873,687 (GRCm39) F101I probably damaging Het
Pakap A G 4: 57,892,963 (GRCm39) E880G probably damaging Het
Pde6b A G 5: 108,575,056 (GRCm39) E639G probably benign Het
Phf10 T C 17: 15,177,071 (GRCm39) T83A probably benign Het
Phkb T A 8: 86,628,549 (GRCm39) I186N possibly damaging Het
Pkhd1 A G 1: 20,636,980 (GRCm39) probably null Het
Plxnd1 C A 6: 115,954,978 (GRCm39) A595S possibly damaging Het
Ppara T A 15: 85,685,300 (GRCm39) H416Q probably damaging Het
Prodh T A 16: 17,898,891 (GRCm39) D188V probably damaging Het
Psmd14 A T 2: 61,615,800 (GRCm39) K223M possibly damaging Het
Ptpn5 A G 7: 46,728,616 (GRCm39) M528T possibly damaging Het
Rassf9 G A 10: 102,380,800 (GRCm39) E59K probably benign Het
Rnf2 A T 1: 151,351,936 (GRCm39) L140H probably damaging Het
Scai A G 2: 38,970,093 (GRCm39) F557S probably damaging Het
Sdk2 A G 11: 113,747,552 (GRCm39) S653P possibly damaging Het
Sec24c A G 14: 20,739,179 (GRCm39) D534G probably benign Het
Semp2l2a T A 8: 13,887,143 (GRCm39) Q316L probably benign Het
Septin4 T C 11: 87,457,838 (GRCm39) S71P probably benign Het
Serinc1 A G 10: 57,395,561 (GRCm39) V375A probably benign Het
Serpinb9f C T 13: 33,509,829 (GRCm39) A7V probably damaging Het
Smco1 T C 16: 32,092,700 (GRCm39) S124P probably damaging Het
Smim23 C A 11: 32,774,441 (GRCm39) C26F possibly damaging Het
Sppl2c T A 11: 104,078,715 (GRCm39) M505K probably benign Het
Sprr1b C A 3: 92,344,775 (GRCm39) V34F possibly damaging Het
Sun1 G A 5: 139,221,487 (GRCm39) probably null Het
Syne2 A G 12: 75,946,020 (GRCm39) D364G possibly damaging Het
Tax1bp1 G T 6: 52,742,937 (GRCm39) V775F probably damaging Het
Tial1 T A 7: 128,046,383 (GRCm39) I231F probably damaging Het
Tiam1 C A 16: 89,595,582 (GRCm39) V1300L probably damaging Het
Tmem132e A G 11: 82,334,243 (GRCm39) T585A probably damaging Het
Tnni3k C T 3: 154,684,836 (GRCm39) A165T probably benign Het
Tomm40 A T 7: 19,444,886 (GRCm39) I165N probably damaging Het
Tomt T C 7: 101,550,454 (GRCm39) E104G probably damaging Het
Topaz1 T C 9: 122,596,078 (GRCm39) S950P possibly damaging Het
Traf3ip2 C G 10: 39,501,936 (GRCm39) P28R probably benign Het
Trim24 C T 6: 37,934,750 (GRCm39) P822S probably damaging Het
Upf3a T G 8: 13,842,108 (GRCm39) Y175D probably damaging Het
Vars2 G A 17: 35,977,814 (GRCm39) P69S probably benign Het
Veph1 T C 3: 66,151,976 (GRCm39) Y151C probably damaging Het
Vmn2r11 T A 5: 109,202,654 (GRCm39) D141V probably benign Het
Vwa5b1 G A 4: 138,319,331 (GRCm39) Q442* probably null Het
Wdr17 T A 8: 55,140,761 (GRCm39) D197V probably damaging Het
Wdr70 G T 15: 7,913,891 (GRCm39) T586N possibly damaging Het
Wfdc18 G A 11: 83,600,754 (GRCm39) G52R probably benign Het
Zc3h6 T C 2: 128,858,540 (GRCm39) I857T probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,723,440 (GRCm39) probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,723,450 (GRCm39) probably benign Het
Zfp647 C T 15: 76,796,151 (GRCm39) V170I probably benign Het
Zfp871 T C 17: 32,994,891 (GRCm39) N76D possibly damaging Het
Zpld2 A G 4: 133,919,986 (GRCm39) probably null Het
Zwilch A G 9: 64,068,234 (GRCm39) Y194H probably damaging Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52,399,255 (GRCm39) missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52,399,148 (GRCm39) missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52,420,589 (GRCm39) missense probably benign
IGL01328:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01329:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01413:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01414:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01535:Supt16 APN 14 52,414,647 (GRCm39) missense probably damaging 0.99
IGL01765:Supt16 APN 14 52,417,680 (GRCm39) missense probably damaging 0.98
IGL01976:Supt16 APN 14 52,419,764 (GRCm39) missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52,417,000 (GRCm39) missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52,411,263 (GRCm39) missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52,421,421 (GRCm39) missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52,408,335 (GRCm39) missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52,413,855 (GRCm39) missense probably damaging 0.98
IGL03406:Supt16 APN 14 52,415,598 (GRCm39) missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52,408,948 (GRCm39) missense possibly damaging 0.93
watercolor UTSW 14 52,408,338 (GRCm39) missense probably damaging 0.96
R0332:Supt16 UTSW 14 52,418,614 (GRCm39) missense probably damaging 0.99
R0385:Supt16 UTSW 14 52,414,175 (GRCm39) missense probably benign 0.01
R0389:Supt16 UTSW 14 52,411,570 (GRCm39) missense probably damaging 0.98
R0422:Supt16 UTSW 14 52,421,453 (GRCm39) missense probably benign 0.26
R1101:Supt16 UTSW 14 52,408,896 (GRCm39) missense probably null 0.81
R1212:Supt16 UTSW 14 52,411,581 (GRCm39) nonsense probably null
R1487:Supt16 UTSW 14 52,414,065 (GRCm39) critical splice donor site probably null
R1494:Supt16 UTSW 14 52,409,916 (GRCm39) missense probably benign 0.01
R1566:Supt16 UTSW 14 52,414,112 (GRCm39) missense probably damaging 0.99
R1652:Supt16 UTSW 14 52,414,637 (GRCm39) missense probably benign 0.34
R2220:Supt16 UTSW 14 52,409,601 (GRCm39) nonsense probably null
R2344:Supt16 UTSW 14 52,415,575 (GRCm39) missense probably benign 0.00
R3430:Supt16 UTSW 14 52,412,816 (GRCm39) missense probably benign 0.05
R3746:Supt16 UTSW 14 52,417,596 (GRCm39) missense probably damaging 0.99
R3749:Supt16 UTSW 14 52,417,596 (GRCm39) missense probably damaging 0.99
R4010:Supt16 UTSW 14 52,401,898 (GRCm39) missense probably damaging 1.00
R4108:Supt16 UTSW 14 52,400,188 (GRCm39) missense probably damaging 1.00
R4109:Supt16 UTSW 14 52,400,188 (GRCm39) missense probably damaging 1.00
R4597:Supt16 UTSW 14 52,411,046 (GRCm39) missense probably damaging 1.00
R5117:Supt16 UTSW 14 52,420,549 (GRCm39) missense probably damaging 1.00
R5309:Supt16 UTSW 14 52,400,155 (GRCm39) missense probably damaging 1.00
R5695:Supt16 UTSW 14 52,411,601 (GRCm39) splice site probably null
R5895:Supt16 UTSW 14 52,401,979 (GRCm39) missense probably benign 0.17
R5941:Supt16 UTSW 14 52,419,653 (GRCm39) missense probably benign
R5993:Supt16 UTSW 14 52,415,791 (GRCm39) missense probably damaging 1.00
R6197:Supt16 UTSW 14 52,408,338 (GRCm39) missense probably damaging 0.96
R6254:Supt16 UTSW 14 52,408,291 (GRCm39) missense probably damaging 1.00
R6381:Supt16 UTSW 14 52,417,003 (GRCm39) missense probably benign 0.02
R6667:Supt16 UTSW 14 52,409,520 (GRCm39) missense probably damaging 1.00
R7000:Supt16 UTSW 14 52,408,907 (GRCm39) missense probably damaging 0.97
R7063:Supt16 UTSW 14 52,409,505 (GRCm39) missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52,414,458 (GRCm39) missense probably benign
R7336:Supt16 UTSW 14 52,408,948 (GRCm39) missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52,411,028 (GRCm39) missense probably damaging 0.98
R7384:Supt16 UTSW 14 52,418,619 (GRCm39) missense probably damaging 0.99
R7411:Supt16 UTSW 14 52,415,508 (GRCm39) missense probably damaging 1.00
R7586:Supt16 UTSW 14 52,411,013 (GRCm39) missense probably damaging 0.97
R7633:Supt16 UTSW 14 52,434,556 (GRCm39) missense probably benign 0.38
R8024:Supt16 UTSW 14 52,408,332 (GRCm39) missense probably damaging 0.96
R8197:Supt16 UTSW 14 52,411,542 (GRCm39) missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52,408,447 (GRCm39) missense probably damaging 1.00
R8285:Supt16 UTSW 14 52,418,540 (GRCm39) missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52,419,046 (GRCm39) missense probably damaging 1.00
R8531:Supt16 UTSW 14 52,410,020 (GRCm39) missense probably damaging 0.98
R8797:Supt16 UTSW 14 52,409,960 (GRCm39) missense probably damaging 0.99
R8872:Supt16 UTSW 14 52,411,544 (GRCm39) missense probably benign 0.01
R9048:Supt16 UTSW 14 52,418,513 (GRCm39) missense probably damaging 1.00
R9743:Supt16 UTSW 14 52,408,939 (GRCm39) missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52,418,994 (GRCm39) missense probably null 0.21
Z1177:Supt16 UTSW 14 52,400,742 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCATGGACTTCCCCACCTAG -3'
(R):5'- ATTCCGTGAAGGCTCTCTAGTAATC -3'

Sequencing Primer
(F):5'- TAGCAACCATCAACAAACTGGAAG -3'
(R):5'- CGTGAAGGCTCTCTAGTAATCAATAG -3'
Posted On 2014-07-14