Incidental Mutation 'R1914:Fnbp4'
ID214652
Institutional Source Beutler Lab
Gene Symbol Fnbp4
Ensembl Gene ENSMUSG00000008200
Gene Nameformin binding protein 4
SynonymsFBP30
MMRRC Submission 039932-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R1914 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90745370-90781021 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 90779193 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013759] [ENSMUST00000037206] [ENSMUST00000037219] [ENSMUST00000051831] [ENSMUST00000111481] [ENSMUST00000136058] [ENSMUST00000170320]
Predicted Effect probably benign
Transcript: ENSMUST00000013759
SMART Domains Protein: ENSMUSP00000013759
Gene: ENSMUSG00000008200

DomainStartEndE-ValueType
low complexity region 65 140 N/A INTRINSIC
low complexity region 165 175 N/A INTRINSIC
low complexity region 204 235 N/A INTRINSIC
WW 265 298 3.58e-5 SMART
low complexity region 372 381 N/A INTRINSIC
low complexity region 386 393 N/A INTRINSIC
low complexity region 404 416 N/A INTRINSIC
coiled coil region 442 478 N/A INTRINSIC
low complexity region 515 533 N/A INTRINSIC
WW 650 683 1.77e-9 SMART
low complexity region 757 788 N/A INTRINSIC
low complexity region 891 909 N/A INTRINSIC
low complexity region 955 1002 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037206
SMART Domains Protein: ENSMUSP00000047936
Gene: ENSMUSG00000040812

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 375 541 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037219
SMART Domains Protein: ENSMUSP00000048647
Gene: ENSMUSG00000040812

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051831
SMART Domains Protein: ENSMUSP00000051620
Gene: ENSMUSG00000040812

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 565 1.6e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111481
SMART Domains Protein: ENSMUSP00000107106
Gene: ENSMUSG00000040812

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135592
Predicted Effect probably benign
Transcript: ENSMUST00000136058
SMART Domains Protein: ENSMUSP00000115632
Gene: ENSMUSG00000040812

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 2.8e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149361
Predicted Effect probably benign
Transcript: ENSMUST00000170320
SMART Domains Protein: ENSMUSP00000129216
Gene: ENSMUSG00000040812

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 558 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (90/91)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,485,850 V618E possibly damaging Het
Abca6 T C 11: 110,212,210 R852G probably benign Het
Akap12 G A 10: 4,356,685 R1165H probably benign Het
Asxl1 T C 2: 153,401,906 S1459P probably damaging Het
Bahcc1 C T 11: 120,285,399 R1957C probably damaging Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Capn15 C A 17: 25,964,863 A215S probably benign Het
Casz1 T C 4: 148,932,958 F235L probably damaging Het
Ccdc57 A T 11: 120,903,308 probably benign Het
Cdh23 A G 10: 60,323,570 V2142A probably damaging Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep104 T C 4: 153,989,839 L516P possibly damaging Het
Cep95 C T 11: 106,814,638 T483I probably damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Diaph3 A C 14: 86,656,485 N29K probably damaging Het
Dnajc2 A G 5: 21,781,319 probably null Het
Ephb1 C T 9: 101,929,378 C819Y probably damaging Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Fezf2 A T 14: 12,343,988 V301E probably damaging Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gas6 T C 8: 13,477,152 T199A probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Grm4 A T 17: 27,434,712 C755S probably damaging Het
Hdgfl2 A G 17: 56,096,978 D278G probably damaging Het
Heatr5a G T 12: 51,905,467 A1130E probably damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Ing1 T A 8: 11,561,577 V63E probably damaging Het
Irf4 A T 13: 30,761,462 Q397L probably benign Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcnh6 T A 11: 106,017,444 Y295* probably null Het
Klf5 T C 14: 99,301,921 S177P probably benign Het
Lats1 T A 10: 7,710,457 probably benign Het
Lilrb4a A G 10: 51,491,949 I53M probably benign Het
Lrrc2 T A 9: 110,980,939 Y348N probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Med25 A G 7: 44,884,622 S245P probably benign Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Naip6 T A 13: 100,299,428 E862D probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nyap2 T C 1: 81,191,887 S120P probably damaging Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pappa2 A T 1: 158,750,563 D1721E probably damaging Het
Pcid2 A T 8: 13,094,141 probably null Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rabggta A T 14: 55,721,189 F62L possibly damaging Het
Rasal3 G A 17: 32,396,350 Q505* probably null Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rpgrip1l T C 8: 91,232,924 D1116G probably benign Het
Rsph4a A T 10: 33,913,072 N638Y probably damaging Het
Scn9a A G 2: 66,566,250 F100L probably damaging Het
Siglece A G 7: 43,657,795 V256A probably benign Het
Slc23a2 A T 2: 132,056,766 L617Q probably damaging Het
Snx9 T C 17: 5,928,256 I567T possibly damaging Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Sugp2 T A 8: 70,253,660 I790K probably damaging Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tbl1xr1 T C 3: 22,190,910 probably benign Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Trim43c T A 9: 88,840,617 D105E probably benign Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Vmn2r18 T C 5: 151,575,821 N393D probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Other mutations in Fnbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Fnbp4 APN 2 90751622 splice site probably benign
IGL00731:Fnbp4 APN 2 90768643 missense probably benign
IGL01021:Fnbp4 APN 2 90777669 missense probably benign 0.06
IGL01097:Fnbp4 APN 2 90776350 missense possibly damaging 0.63
IGL02504:Fnbp4 APN 2 90768543 missense probably damaging 1.00
IGL02510:Fnbp4 APN 2 90751475 missense probably benign
IGL02673:Fnbp4 APN 2 90763472 missense probably benign 0.01
IGL03024:Fnbp4 APN 2 90751179 missense probably benign 0.11
IGL03221:Fnbp4 APN 2 90777718 missense possibly damaging 0.65
R0570:Fnbp4 UTSW 2 90752957 missense probably damaging 1.00
R1925:Fnbp4 UTSW 2 90765843 missense probably damaging 1.00
R2051:Fnbp4 UTSW 2 90757532 missense probably benign 0.05
R2069:Fnbp4 UTSW 2 90758372 missense probably damaging 1.00
R2165:Fnbp4 UTSW 2 90767399 splice site probably null
R2262:Fnbp4 UTSW 2 90757404 missense probably damaging 1.00
R3836:Fnbp4 UTSW 2 90746785 missense probably damaging 1.00
R4077:Fnbp4 UTSW 2 90758477 nonsense probably null
R4356:Fnbp4 UTSW 2 90758339 missense probably damaging 1.00
R4401:Fnbp4 UTSW 2 90746758 missense possibly damaging 0.62
R4491:Fnbp4 UTSW 2 90752968 critical splice donor site probably null
R4914:Fnbp4 UTSW 2 90751169 missense probably benign 0.00
R4981:Fnbp4 UTSW 2 90765830 missense probably damaging 1.00
R5165:Fnbp4 UTSW 2 90777657 missense possibly damaging 0.65
R5272:Fnbp4 UTSW 2 90753115 missense probably benign
R5683:Fnbp4 UTSW 2 90752862 missense probably damaging 1.00
R5860:Fnbp4 UTSW 2 90757482 missense probably benign 0.00
R5905:Fnbp4 UTSW 2 90751134 missense probably benign 0.29
R5914:Fnbp4 UTSW 2 90774793 intron probably benign
R6028:Fnbp4 UTSW 2 90751134 missense probably benign 0.29
R6270:Fnbp4 UTSW 2 90757463 missense probably damaging 1.00
R6379:Fnbp4 UTSW 2 90751124 missense probably benign 0.41
R6389:Fnbp4 UTSW 2 90745535 missense unknown
R6883:Fnbp4 UTSW 2 90745828 critical splice donor site probably null
R6940:Fnbp4 UTSW 2 90745514 missense unknown
R7242:Fnbp4 UTSW 2 90745796 missense unknown
R7393:Fnbp4 UTSW 2 90779316 missense probably damaging 0.99
R7454:Fnbp4 UTSW 2 90777815 unclassified probably benign
R7455:Fnbp4 UTSW 2 90777815 unclassified probably benign
R8051:Fnbp4 UTSW 2 90777739 missense possibly damaging 0.77
R8283:Fnbp4 UTSW 2 90746771 missense probably damaging 0.98
R8724:Fnbp4 UTSW 2 90746753 missense probably damaging 1.00
R8845:Fnbp4 UTSW 2 90776024 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAGGAACTCCCATCAACG -3'
(R):5'- CATTCTCCATGAAGGGCTGTAAC -3'

Sequencing Primer
(F):5'- CCCAGTCTTGTGTAGGCAGTACAG -3'
(R):5'- CCATGAAGGGCTGTAACTTTAAGAC -3'
Posted On2014-07-14