Incidental Mutation 'R1914:Dnajc2'
ID214667
Institutional Source Beutler Lab
Gene Symbol Dnajc2
Ensembl Gene ENSMUSG00000029014
Gene NameDnaJ heat shock protein family (Hsp40) member C2
SynonymsMIDA1, Zrf1, Mida1, Zrf2
MMRRC Submission 039932-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R1914 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21757267-21785251 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 21781319 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030769] [ENSMUST00000030771] [ENSMUST00000115192] [ENSMUST00000115192] [ENSMUST00000115193] [ENSMUST00000115195] [ENSMUST00000115195]
Predicted Effect probably benign
Transcript: ENSMUST00000030769
SMART Domains Protein: ENSMUSP00000030769
Gene: ENSMUSG00000028932

DomainStartEndE-ValueType
low complexity region 114 125 N/A INTRINSIC
AAA 250 389 2.74e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000030771
SMART Domains Protein: ENSMUSP00000030771
Gene: ENSMUSG00000029014

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
low complexity region 231 245 N/A INTRINSIC
low complexity region 281 319 N/A INTRINSIC
Pfam:RAC_head 339 430 2.8e-24 PFAM
SANT 450 509 6.64e-10 SMART
SANT 550 602 2.4e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115192
SMART Domains Protein: ENSMUSP00000110846
Gene: ENSMUSG00000029014

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115192
SMART Domains Protein: ENSMUSP00000110846
Gene: ENSMUSG00000029014

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115193
SMART Domains Protein: ENSMUSP00000110847
Gene: ENSMUSG00000029014

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
coiled coil region 230 358 N/A INTRINSIC
coiled coil region 404 445 N/A INTRINSIC
SANT 450 509 6.64e-10 SMART
SANT 550 602 1.34e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115195
SMART Domains Protein: ENSMUSP00000110849
Gene: ENSMUSG00000029014

DomainStartEndE-ValueType
DnaJ 13 79 2.16e-18 SMART
coiled coil region 156 284 N/A INTRINSIC
coiled coil region 330 371 N/A INTRINSIC
SANT 376 435 6.64e-10 SMART
SANT 476 528 2.4e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115195
SMART Domains Protein: ENSMUSP00000110849
Gene: ENSMUSG00000029014

DomainStartEndE-ValueType
DnaJ 13 79 2.16e-18 SMART
coiled coil region 156 284 N/A INTRINSIC
coiled coil region 330 371 N/A INTRINSIC
SANT 376 435 6.64e-10 SMART
SANT 476 528 2.4e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147987
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the M-phase phosphoprotein (MPP) family. The gene encodes a phosphoprotein with a J domain and a Myb DNA-binding domain which localizes to both the nucleus and the cytosol. The protein is capable of forming a heterodimeric complex that associates with ribosomes, acting as a molecular chaperone for nascent polypeptide chains as they exit the ribosome. This protein was identified as a leukemia-associated antigen and expression of the gene is upregulated in leukemic blasts. Also, chromosomal aberrations involving this gene are associated with primary head and neck squamous cell tumors. This gene has a pseudogene on chromosome 6. Alternatively spliced variants which encode different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,485,850 V618E possibly damaging Het
Abca6 T C 11: 110,212,210 R852G probably benign Het
Akap12 G A 10: 4,356,685 R1165H probably benign Het
Asxl1 T C 2: 153,401,906 S1459P probably damaging Het
Bahcc1 C T 11: 120,285,399 R1957C probably damaging Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Capn15 C A 17: 25,964,863 A215S probably benign Het
Casz1 T C 4: 148,932,958 F235L probably damaging Het
Ccdc57 A T 11: 120,903,308 probably benign Het
Cdh23 A G 10: 60,323,570 V2142A probably damaging Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep104 T C 4: 153,989,839 L516P possibly damaging Het
Cep95 C T 11: 106,814,638 T483I probably damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Diaph3 A C 14: 86,656,485 N29K probably damaging Het
Ephb1 C T 9: 101,929,378 C819Y probably damaging Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Fezf2 A T 14: 12,343,988 V301E probably damaging Het
Fnbp4 T C 2: 90,779,193 probably benign Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gas6 T C 8: 13,477,152 T199A probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Grm4 A T 17: 27,434,712 C755S probably damaging Het
Hdgfl2 A G 17: 56,096,978 D278G probably damaging Het
Heatr5a G T 12: 51,905,467 A1130E probably damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Ing1 T A 8: 11,561,577 V63E probably damaging Het
Irf4 A T 13: 30,761,462 Q397L probably benign Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcnh6 T A 11: 106,017,444 Y295* probably null Het
Klf5 T C 14: 99,301,921 S177P probably benign Het
Lats1 T A 10: 7,710,457 probably benign Het
Lilrb4a A G 10: 51,491,949 I53M probably benign Het
Lrrc2 T A 9: 110,980,939 Y348N probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Med25 A G 7: 44,884,622 S245P probably benign Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Naip6 T A 13: 100,299,428 E862D probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nyap2 T C 1: 81,191,887 S120P probably damaging Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pappa2 A T 1: 158,750,563 D1721E probably damaging Het
Pcid2 A T 8: 13,094,141 probably null Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rabggta A T 14: 55,721,189 F62L possibly damaging Het
Rasal3 G A 17: 32,396,350 Q505* probably null Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rpgrip1l T C 8: 91,232,924 D1116G probably benign Het
Rsph4a A T 10: 33,913,072 N638Y probably damaging Het
Scn9a A G 2: 66,566,250 F100L probably damaging Het
Siglece A G 7: 43,657,795 V256A probably benign Het
Slc23a2 A T 2: 132,056,766 L617Q probably damaging Het
Snx9 T C 17: 5,928,256 I567T possibly damaging Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Sugp2 T A 8: 70,253,660 I790K probably damaging Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tbl1xr1 T C 3: 22,190,910 probably benign Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Trim43c T A 9: 88,840,617 D105E probably benign Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Vmn2r18 T C 5: 151,575,821 N393D probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Other mutations in Dnajc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Dnajc2 APN 5 21774976 missense possibly damaging 0.83
IGL01479:Dnajc2 APN 5 21757893 missense probably damaging 1.00
IGL01804:Dnajc2 APN 5 21757363 missense probably damaging 1.00
IGL02478:Dnajc2 APN 5 21776790 missense probably damaging 1.00
IGL02552:Dnajc2 APN 5 21783063 missense probably damaging 1.00
IGL02657:Dnajc2 APN 5 21770481 splice site probably benign
IGL02832:Dnajc2 APN 5 21760410 missense probably benign
IGL03177:Dnajc2 APN 5 21775081 splice site probably benign
R1915:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R2024:Dnajc2 UTSW 5 21776790 missense probably damaging 1.00
R2437:Dnajc2 UTSW 5 21760391 missense probably benign 0.06
R4177:Dnajc2 UTSW 5 21757396 missense probably benign 0.28
R4451:Dnajc2 UTSW 5 21757794 missense possibly damaging 0.93
R4812:Dnajc2 UTSW 5 21763486 missense probably benign 0.03
R4916:Dnajc2 UTSW 5 21757340 missense probably damaging 1.00
R5013:Dnajc2 UTSW 5 21757773 nonsense probably null
R5094:Dnajc2 UTSW 5 21776732 missense probably damaging 1.00
R5124:Dnajc2 UTSW 5 21763484 missense probably benign
R5891:Dnajc2 UTSW 5 21761711 missense possibly damaging 0.67
R6192:Dnajc2 UTSW 5 21768648 missense probably damaging 1.00
R6567:Dnajc2 UTSW 5 21766678 missense probably damaging 1.00
R7211:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7216:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7418:Dnajc2 UTSW 5 21760624 critical splice donor site probably null
R7728:Dnajc2 UTSW 5 21770540 missense possibly damaging 0.62
R7877:Dnajc2 UTSW 5 21760639 missense possibly damaging 0.88
R7960:Dnajc2 UTSW 5 21760639 missense possibly damaging 0.88
RF040:Dnajc2 UTSW 5 21757697 makesense probably null
X0027:Dnajc2 UTSW 5 21773811 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AACCCGTTTCCTTGATGGG -3'
(R):5'- GGAACTCGGGCTCATTTCATG -3'

Sequencing Primer
(F):5'- CCTTGATGGGCAATGATTCTTACAG -3'
(R):5'- GAACTCGGGCTCATTTCATGCTAAG -3'
Posted On2014-07-14