Incidental Mutation 'R1914:Rpgrip1l'
ID214686
Institutional Source Beutler Lab
Gene Symbol Rpgrip1l
Ensembl Gene ENSMUSG00000033282
Gene NameRpgrip1-like
SynonymsNphp8, fantom, Ftm, 1700047E16Rik
MMRRC Submission 039932-MU
Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1914 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location91217030-91313262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91232924 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1116 (D1116G)
Ref Sequence ENSEMBL: ENSMUSP00000042702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113]
Predicted Effect probably benign
Transcript: ENSMUST00000047783
AA Change: D1116G

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: D1116G

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
coiled coil region 196 268 N/A INTRINSIC
coiled coil region 299 371 N/A INTRINSIC
coiled coil region 395 454 N/A INTRINSIC
coiled coil region 520 556 N/A INTRINSIC
Pfam:C2-C2_1 597 738 5.8e-61 PFAM
low complexity region 769 778 N/A INTRINSIC
C2 791 896 1.06e-5 SMART
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1057 1080 N/A INTRINSIC
Blast:C2 1098 1223 3e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139113
SMART Domains Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210538
Meta Mutation Damage Score 0.1274 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (90/91)
MGI Phenotype Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,485,850 V618E possibly damaging Het
Abca6 T C 11: 110,212,210 R852G probably benign Het
Akap12 G A 10: 4,356,685 R1165H probably benign Het
Asxl1 T C 2: 153,401,906 S1459P probably damaging Het
Bahcc1 C T 11: 120,285,399 R1957C probably damaging Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Capn15 C A 17: 25,964,863 A215S probably benign Het
Casz1 T C 4: 148,932,958 F235L probably damaging Het
Ccdc57 A T 11: 120,903,308 probably benign Het
Cdh23 A G 10: 60,323,570 V2142A probably damaging Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep104 T C 4: 153,989,839 L516P possibly damaging Het
Cep95 C T 11: 106,814,638 T483I probably damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Diaph3 A C 14: 86,656,485 N29K probably damaging Het
Dnajc2 A G 5: 21,781,319 probably null Het
Ephb1 C T 9: 101,929,378 C819Y probably damaging Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Fezf2 A T 14: 12,343,988 V301E probably damaging Het
Fnbp4 T C 2: 90,779,193 probably benign Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gas6 T C 8: 13,477,152 T199A probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Grm4 A T 17: 27,434,712 C755S probably damaging Het
Hdgfl2 A G 17: 56,096,978 D278G probably damaging Het
Heatr5a G T 12: 51,905,467 A1130E probably damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Ing1 T A 8: 11,561,577 V63E probably damaging Het
Irf4 A T 13: 30,761,462 Q397L probably benign Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcnh6 T A 11: 106,017,444 Y295* probably null Het
Klf5 T C 14: 99,301,921 S177P probably benign Het
Lats1 T A 10: 7,710,457 probably benign Het
Lilrb4a A G 10: 51,491,949 I53M probably benign Het
Lrrc2 T A 9: 110,980,939 Y348N probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Med25 A G 7: 44,884,622 S245P probably benign Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Naip6 T A 13: 100,299,428 E862D probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nyap2 T C 1: 81,191,887 S120P probably damaging Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pappa2 A T 1: 158,750,563 D1721E probably damaging Het
Pcid2 A T 8: 13,094,141 probably null Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rabggta A T 14: 55,721,189 F62L possibly damaging Het
Rasal3 G A 17: 32,396,350 Q505* probably null Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rsph4a A T 10: 33,913,072 N638Y probably damaging Het
Scn9a A G 2: 66,566,250 F100L probably damaging Het
Siglece A G 7: 43,657,795 V256A probably benign Het
Slc23a2 A T 2: 132,056,766 L617Q probably damaging Het
Snx9 T C 17: 5,928,256 I567T possibly damaging Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Sugp2 T A 8: 70,253,660 I790K probably damaging Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tbl1xr1 T C 3: 22,190,910 probably benign Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Trim43c T A 9: 88,840,617 D105E probably benign Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Vmn2r18 T C 5: 151,575,821 N393D probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Other mutations in Rpgrip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rpgrip1l APN 8 91263574 missense possibly damaging 0.52
IGL00932:Rpgrip1l APN 8 91275637 missense probably benign 0.33
IGL01113:Rpgrip1l APN 8 91260739 intron probably benign
IGL01151:Rpgrip1l APN 8 91275149 missense probably damaging 1.00
IGL01321:Rpgrip1l APN 8 91260873 nonsense probably null
IGL01384:Rpgrip1l APN 8 91273640 missense probably benign 0.00
IGL01634:Rpgrip1l APN 8 91252543 missense probably benign
IGL01634:Rpgrip1l APN 8 91252544 missense probably benign 0.25
IGL01781:Rpgrip1l APN 8 91270218 missense probably benign 0.16
IGL01784:Rpgrip1l APN 8 91270461 missense possibly damaging 0.56
IGL02034:Rpgrip1l APN 8 91251148 critical splice donor site probably null
IGL02250:Rpgrip1l APN 8 91232861 missense probably benign 0.00
IGL02285:Rpgrip1l APN 8 91232907 missense possibly damaging 0.92
IGL02634:Rpgrip1l APN 8 91225344 splice site probably benign
IGL02736:Rpgrip1l APN 8 91263591 missense possibly damaging 0.91
IGL02825:Rpgrip1l APN 8 91304805 missense probably damaging 0.99
IGL02962:Rpgrip1l APN 8 91270362 missense possibly damaging 0.95
IGL03031:Rpgrip1l APN 8 91260783 missense probably damaging 1.00
IGL03184:Rpgrip1l APN 8 91300809 missense probably damaging 1.00
P0005:Rpgrip1l UTSW 8 91299225 splice site probably benign
R0118:Rpgrip1l UTSW 8 91270122 missense probably damaging 1.00
R0490:Rpgrip1l UTSW 8 91299845 splice site probably benign
R0599:Rpgrip1l UTSW 8 91305000 missense probably damaging 1.00
R1514:Rpgrip1l UTSW 8 91260750 missense probably damaging 1.00
R1648:Rpgrip1l UTSW 8 91252889 missense probably damaging 1.00
R1915:Rpgrip1l UTSW 8 91232924 missense probably benign 0.13
R2093:Rpgrip1l UTSW 8 91270132 missense possibly damaging 0.87
R2225:Rpgrip1l UTSW 8 91221467 missense probably benign 0.45
R2504:Rpgrip1l UTSW 8 91280716 critical splice donor site probably null
R3859:Rpgrip1l UTSW 8 91263658 missense probably benign 0.00
R4118:Rpgrip1l UTSW 8 91252907 missense probably benign
R4801:Rpgrip1l UTSW 8 91270177 missense probably damaging 1.00
R4802:Rpgrip1l UTSW 8 91270177 missense probably damaging 1.00
R4921:Rpgrip1l UTSW 8 91261009 missense probably benign 0.05
R4976:Rpgrip1l UTSW 8 91280816 missense probably damaging 1.00
R5092:Rpgrip1l UTSW 8 91221384 nonsense probably null
R5099:Rpgrip1l UTSW 8 91248722 missense probably benign 0.20
R5119:Rpgrip1l UTSW 8 91280816 missense probably damaging 1.00
R5141:Rpgrip1l UTSW 8 91260918 missense probably benign 0.29
R5793:Rpgrip1l UTSW 8 91260772 missense probably benign 0.06
R5847:Rpgrip1l UTSW 8 91304985 missense probably damaging 1.00
R5871:Rpgrip1l UTSW 8 91221386 missense possibly damaging 0.89
R5916:Rpgrip1l UTSW 8 91252913 missense possibly damaging 0.93
R6619:Rpgrip1l UTSW 8 91232871 missense possibly damaging 0.69
R6654:Rpgrip1l UTSW 8 91220205 missense probably benign 0.36
R6956:Rpgrip1l UTSW 8 91286313 splice site probably null
R6984:Rpgrip1l UTSW 8 91260798 missense probably benign 0.03
R7064:Rpgrip1l UTSW 8 91263520 nonsense probably null
R7145:Rpgrip1l UTSW 8 91232806 critical splice donor site probably null
R7243:Rpgrip1l UTSW 8 91270123 missense probably benign 0.00
R7673:Rpgrip1l UTSW 8 91300787 missense possibly damaging 0.89
R7796:Rpgrip1l UTSW 8 91270237 missense probably damaging 1.00
Z1088:Rpgrip1l UTSW 8 91220179 makesense probably null
Z1088:Rpgrip1l UTSW 8 91260975 missense possibly damaging 0.96
Z1088:Rpgrip1l UTSW 8 91270120 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TACCTTAGCTTCCTTCACAGACAG -3'
(R):5'- TGGAATGTATGGGAGCATACAC -3'

Sequencing Primer
(F):5'- TAGCTTCCTTCACAGACAGGAAAAAC -3'
(R):5'- TATGGGAGCATACACTGTGC -3'
Posted On2014-07-14