Mutagenetix > Incidental Mutations

Incidental Mutation 'R1914:Lats1'

214696

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

039932-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.810) question?

Stock #

R1914 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 7710457 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

Predicted Effect

probably benign
Transcript: ENSMUST00000040043

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165952

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217931

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.1%
20x: 91.6%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,485,850	V618E	possibly damaging	Het
Abca6	T	C	11: 110,212,210	R852G	probably benign	Het
Akap12	G	A	10: 4,356,685	R1165H	probably benign	Het
Asxl1	T	C	2: 153,401,906	S1459P	probably damaging	Het
Bahcc1	C	T	11: 120,285,399	R1957C	probably damaging	Het
Bcar1	A	G	8: 111,715,398	V270A	probably damaging	Het
Camsap3	C	T	8: 3,604,708	R782C	probably damaging	Het
Capn15	C	A	17: 25,964,863	A215S	probably benign	Het
Casz1	T	C	4: 148,932,958	F235L	probably damaging	Het
Ccdc57	A	T	11: 120,903,308		probably benign	Het
Cdh23	A	G	10: 60,323,570	V2142A	probably damaging	Het
Cdx1	A	G	18: 61,019,898	V212A	probably benign	Het
Cep104	T	C	4: 153,989,839	L516P	possibly damaging	Het
Cep95	C	T	11: 106,814,638	T483I	probably damaging	Het
Cfap100	T	C	6: 90,412,347		probably benign	Het
Chia1	T	A	3: 106,128,559	N238K	probably benign	Het
Cntrl	T	C	2: 35,162,861	M1126T	probably benign	Het
Col28a1	A	G	6: 8,176,333	F8S	probably benign	Het
Cpeb3	C	T	19: 37,054,265	R579Q	probably damaging	Het
Dbh	A	G	2: 27,168,222	D134G	probably damaging	Het
Diaph3	A	C	14: 86,656,485	N29K	probably damaging	Het
Dnajc2	A	G	5: 21,781,319		probably null	Het
Ephb1	C	T	9: 101,929,378	C819Y	probably damaging	Het
Eps8l2	G	A	7: 141,361,852	V650M	probably damaging	Het
Erlin1	T	C	19: 44,059,065	Y139C	probably damaging	Het
Fezf2	A	T	14: 12,343,988	V301E	probably damaging	Het
Fnbp4	T	C	2: 90,779,193		probably benign	Het
Gal3st4	T	A	5: 138,265,410	K442N	probably benign	Het
Gas6	T	C	8: 13,477,152	T199A	probably benign	Het
Gm10644	G	A	8: 83,933,850		probably benign	Het
Gpr88	G	T	3: 116,252,424	S79R	possibly damaging	Het
Grm4	A	T	17: 27,434,712	C755S	probably damaging	Het
Hdgfl2	A	G	17: 56,096,978	D278G	probably damaging	Het
Heatr5a	G	T	12: 51,905,467	A1130E	probably damaging	Het
Heatr9	T	G	11: 83,518,209	I171L	possibly damaging	Het
Hectd4	A	G	5: 121,322,294	T2209A	probably benign	Het
Hsh2d	A	G	8: 72,193,521	T21A	probably damaging	Het
Ing1	T	A	8: 11,561,577	V63E	probably damaging	Het
Irf4	A	T	13: 30,761,462	Q397L	probably benign	Het
Itgae	T	A	11: 73,118,643		probably benign	Het
Jrkl	A	T	9: 13,245,604	D17E	possibly damaging	Het
Kcnh6	T	A	11: 106,017,444	Y295*	probably null	Het
Klf5	T	C	14: 99,301,921	S177P	probably benign	Het
Lilrb4a	A	G	10: 51,491,949	I53M	probably benign	Het
Lrrc2	T	A	9: 110,980,939	Y348N	probably damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Med25	A	G	7: 44,884,622	S245P	probably benign	Het
Mlh3	T	C	12: 85,261,668	Y1115C	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myh10	T	C	11: 68,790,208	L1025P	probably damaging	Het
Myof	T	A	19: 37,977,693	N393I	probably damaging	Het
Naip6	T	A	13: 100,299,428	E862D	probably benign	Het
Ncald	C	T	15: 37,397,080	A119T	probably benign	Het
Nipbl	T	C	15: 8,343,630	E1044G	possibly damaging	Het
Nyap2	T	C	1: 81,191,887	S120P	probably damaging	Het
Oas1a	A	T	5: 120,905,813	N85K	possibly damaging	Het
Olfr870	T	C	9: 20,171,028	Y181C	probably benign	Het
Pappa2	A	T	1: 158,750,563	D1721E	probably damaging	Het
Pcid2	A	T	8: 13,094,141		probably null	Het
Pou2f2	C	T	7: 25,100,156	A92T	possibly damaging	Het
Ppp1r16a	T	C	15: 76,693,068	L212P	probably damaging	Het
Ptbp3	A	T	4: 59,517,635	L84Q	probably damaging	Het
Ptgr2	A	T	12: 84,302,322	Q145L	probably benign	Het
Pudp	T	C	18: 50,568,207	N152D	probably benign	Het
Rabggta	A	T	14: 55,721,189	F62L	possibly damaging	Het
Rasal3	G	A	17: 32,396,350	Q505*	probably null	Het
Rbm20	T	A	19: 53,864,087	L1166Q	probably damaging	Het
Rictor	T	G	15: 6,759,572	I223R	probably damaging	Het
Ripor1	A	T	8: 105,616,886	E270D	probably damaging	Het
Rorc	T	C	3: 94,391,173	C322R	probably damaging	Het
Rpgrip1l	T	C	8: 91,232,924	D1116G	probably benign	Het
Rsph4a	A	T	10: 33,913,072	N638Y	probably damaging	Het
Scn9a	A	G	2: 66,566,250	F100L	probably damaging	Het
Siglece	A	G	7: 43,657,795	V256A	probably benign	Het
Slc23a2	A	T	2: 132,056,766	L617Q	probably damaging	Het
Snx9	T	C	17: 5,928,256	I567T	possibly damaging	Het
Sptan1	C	G	2: 30,011,036	Q1425E	probably benign	Het
Srd5a3	G	A	5: 76,147,705	V81I	probably benign	Het
Sugp2	T	A	8: 70,253,660	I790K	probably damaging	Het
Syde2	T	G	3: 146,014,316	Y764*	probably null	Het
Tbl1xr1	T	C	3: 22,190,910		probably benign	Het
Tmem130	A	G	5: 144,737,856	F353S	probably damaging	Het
Tmem131	T	A	1: 36,796,266	K1591N	probably damaging	Het
Trim43c	T	A	9: 88,840,617	D105E	probably benign	Het
Urb2	C	A	8: 124,029,798	T748K	possibly damaging	Het
Vmn2r18	T	C	5: 151,575,821	N393D	probably benign	Het
Zfp292	G	A	4: 34,805,100	S2648F	possibly damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTTTAGCCACGACTCATGAC -3'
(R):5'- GGTGCAATATAATTGGGAGTCCC -3'

Sequencing Primer
(F):5'- GCCACGACTCATGACTTATATTG -3'
(R):5'- GGAGTCCCAACCAGAGAATG -3'

Posted On

2014-07-14