Incidental Mutation 'R1914:Cep95'
ID214704
Institutional Source Beutler Lab
Gene Symbol Cep95
Ensembl Gene ENSMUSG00000018372
Gene Namecentrosomal protein 95
SynonymsF630025I20Rik, Ccdc45, 4732496G21Rik
MMRRC Submission 039932-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R1914 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106789252-106819930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106814638 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 483 (T483I)
Ref Sequence ENSEMBL: ENSMUSP00000099357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018516] [ENSMUST00000103068] [ENSMUST00000124898]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018516
AA Change: T526I

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018516
Gene: ENSMUSG00000018372
AA Change: T526I

DomainStartEndE-ValueType
low complexity region 389 407 N/A INTRINSIC
coiled coil region 584 633 N/A INTRINSIC
coiled coil region 701 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103068
AA Change: T483I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099357
Gene: ENSMUSG00000018372
AA Change: T483I

DomainStartEndE-ValueType
low complexity region 346 364 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
coiled coil region 658 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124898
SMART Domains Protein: ENSMUSP00000122454
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
coiled coil region 7 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151282
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (90/91)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,485,850 V618E possibly damaging Het
Abca6 T C 11: 110,212,210 R852G probably benign Het
Akap12 G A 10: 4,356,685 R1165H probably benign Het
Asxl1 T C 2: 153,401,906 S1459P probably damaging Het
Bahcc1 C T 11: 120,285,399 R1957C probably damaging Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Capn15 C A 17: 25,964,863 A215S probably benign Het
Casz1 T C 4: 148,932,958 F235L probably damaging Het
Ccdc57 A T 11: 120,903,308 probably benign Het
Cdh23 A G 10: 60,323,570 V2142A probably damaging Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep104 T C 4: 153,989,839 L516P possibly damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Diaph3 A C 14: 86,656,485 N29K probably damaging Het
Dnajc2 A G 5: 21,781,319 probably null Het
Ephb1 C T 9: 101,929,378 C819Y probably damaging Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Fezf2 A T 14: 12,343,988 V301E probably damaging Het
Fnbp4 T C 2: 90,779,193 probably benign Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gas6 T C 8: 13,477,152 T199A probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Grm4 A T 17: 27,434,712 C755S probably damaging Het
Hdgfl2 A G 17: 56,096,978 D278G probably damaging Het
Heatr5a G T 12: 51,905,467 A1130E probably damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Ing1 T A 8: 11,561,577 V63E probably damaging Het
Irf4 A T 13: 30,761,462 Q397L probably benign Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcnh6 T A 11: 106,017,444 Y295* probably null Het
Klf5 T C 14: 99,301,921 S177P probably benign Het
Lats1 T A 10: 7,710,457 probably benign Het
Lilrb4a A G 10: 51,491,949 I53M probably benign Het
Lrrc2 T A 9: 110,980,939 Y348N probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Med25 A G 7: 44,884,622 S245P probably benign Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Naip6 T A 13: 100,299,428 E862D probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nyap2 T C 1: 81,191,887 S120P probably damaging Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pappa2 A T 1: 158,750,563 D1721E probably damaging Het
Pcid2 A T 8: 13,094,141 probably null Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rabggta A T 14: 55,721,189 F62L possibly damaging Het
Rasal3 G A 17: 32,396,350 Q505* probably null Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rpgrip1l T C 8: 91,232,924 D1116G probably benign Het
Rsph4a A T 10: 33,913,072 N638Y probably damaging Het
Scn9a A G 2: 66,566,250 F100L probably damaging Het
Siglece A G 7: 43,657,795 V256A probably benign Het
Slc23a2 A T 2: 132,056,766 L617Q probably damaging Het
Snx9 T C 17: 5,928,256 I567T possibly damaging Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Sugp2 T A 8: 70,253,660 I790K probably damaging Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tbl1xr1 T C 3: 22,190,910 probably benign Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Trim43c T A 9: 88,840,617 D105E probably benign Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Vmn2r18 T C 5: 151,575,821 N393D probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Other mutations in Cep95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cep95 APN 11 106818217 missense probably damaging 0.98
IGL00988:Cep95 APN 11 106806394 missense probably benign 0.00
IGL01306:Cep95 APN 11 106813815 missense probably benign 0.00
IGL01995:Cep95 APN 11 106806371 missense probably damaging 1.00
IGL02541:Cep95 APN 11 106815581 missense probably damaging 0.99
ANU23:Cep95 UTSW 11 106813815 missense probably benign 0.00
R0071:Cep95 UTSW 11 106790728 unclassified probably benign
R0071:Cep95 UTSW 11 106790728 unclassified probably benign
R0255:Cep95 UTSW 11 106811271 missense probably benign 0.10
R0427:Cep95 UTSW 11 106790752 missense probably benign 0.18
R0436:Cep95 UTSW 11 106818685 missense probably null 0.98
R0583:Cep95 UTSW 11 106814623 missense probably benign
R0831:Cep95 UTSW 11 106814704 missense probably benign 0.00
R1459:Cep95 UTSW 11 106817955 missense probably damaging 1.00
R1589:Cep95 UTSW 11 106800104 missense probably benign 0.00
R1627:Cep95 UTSW 11 106809705 missense probably damaging 1.00
R1768:Cep95 UTSW 11 106806351 nonsense probably null
R1915:Cep95 UTSW 11 106814638 missense probably damaging 1.00
R1928:Cep95 UTSW 11 106790728 unclassified probably benign
R2495:Cep95 UTSW 11 106809282 missense possibly damaging 0.73
R3157:Cep95 UTSW 11 106809187 splice site probably benign
R3158:Cep95 UTSW 11 106809187 splice site probably benign
R3712:Cep95 UTSW 11 106811286 nonsense probably null
R3881:Cep95 UTSW 11 106806292 missense probably damaging 0.98
R4739:Cep95 UTSW 11 106815734 missense probably benign 0.34
R4908:Cep95 UTSW 11 106811346 missense probably damaging 1.00
R4989:Cep95 UTSW 11 106816654 unclassified probably null
R5913:Cep95 UTSW 11 106818509 unclassified probably benign
R5925:Cep95 UTSW 11 106812401 missense probably benign 0.00
R6291:Cep95 UTSW 11 106815596 missense probably damaging 1.00
R6540:Cep95 UTSW 11 106801502 missense probably damaging 0.97
R6924:Cep95 UTSW 11 106811197 missense probably damaging 0.99
R6985:Cep95 UTSW 11 106818703 missense probably damaging 0.99
R7156:Cep95 UTSW 11 106809224 missense possibly damaging 0.84
X0028:Cep95 UTSW 11 106812410 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTACTAACGTGGGGAAAGGC -3'
(R):5'- AGGGACTTTTGACAGCTAACTG -3'

Sequencing Primer
(F):5'- CTGGTTTGTTGGGGGAGAGAAAAC -3'
(R):5'- CTGTTTTCAGCAGCCTCTGGAATG -3'
Posted On2014-07-14