Incidental Mutation 'R1914:Irf4'
ID214711
Institutional Source Beutler Lab
Gene Symbol Irf4
Ensembl Gene ENSMUSG00000021356
Gene Nameinterferon regulatory factor 4
SynonymsIRF-4, Spip
MMRRC Submission 039932-MU
Accession Numbers

Genbank: NM_013674; MGI: 1096873

Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R1914 (G1)
Quality Score184
Status Validated
Chromosome13
Chromosomal Location30749226-30766976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30761462 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 397 (Q397L)
Ref Sequence ENSEMBL: ENSMUSP00000021784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021784] [ENSMUST00000110307]
Predicted Effect probably benign
Transcript: ENSMUST00000021784
AA Change: Q397L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021784
Gene: ENSMUSG00000021356
AA Change: Q397L

DomainStartEndE-ValueType
IRF 17 130 6.96e-64 SMART
IRF-3 249 418 1.17e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110307
AA Change: Q396L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105936
Gene: ENSMUSG00000021356
AA Change: Q396L

DomainStartEndE-ValueType
IRF 17 130 6.96e-64 SMART
IRF-3 248 417 1.17e-84 SMART
Meta Mutation Damage Score 0.1253 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display immune system abnormalities involving development of both T and B cells and affecting susceptibility to both bacterial and viral infections as well as impaired thermogenic gene expression and energy expenditure. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,485,850 V618E possibly damaging Het
Abca6 T C 11: 110,212,210 R852G probably benign Het
Akap12 G A 10: 4,356,685 R1165H probably benign Het
Asxl1 T C 2: 153,401,906 S1459P probably damaging Het
Bahcc1 C T 11: 120,285,399 R1957C probably damaging Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Capn15 C A 17: 25,964,863 A215S probably benign Het
Casz1 T C 4: 148,932,958 F235L probably damaging Het
Ccdc57 A T 11: 120,903,308 probably benign Het
Cdh23 A G 10: 60,323,570 V2142A probably damaging Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep104 T C 4: 153,989,839 L516P possibly damaging Het
Cep95 C T 11: 106,814,638 T483I probably damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Diaph3 A C 14: 86,656,485 N29K probably damaging Het
Dnajc2 A G 5: 21,781,319 probably null Het
Ephb1 C T 9: 101,929,378 C819Y probably damaging Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Fezf2 A T 14: 12,343,988 V301E probably damaging Het
Fnbp4 T C 2: 90,779,193 probably benign Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gas6 T C 8: 13,477,152 T199A probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Grm4 A T 17: 27,434,712 C755S probably damaging Het
Hdgfl2 A G 17: 56,096,978 D278G probably damaging Het
Heatr5a G T 12: 51,905,467 A1130E probably damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Ing1 T A 8: 11,561,577 V63E probably damaging Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcnh6 T A 11: 106,017,444 Y295* probably null Het
Klf5 T C 14: 99,301,921 S177P probably benign Het
Lats1 T A 10: 7,710,457 probably benign Het
Lilrb4a A G 10: 51,491,949 I53M probably benign Het
Lrrc2 T A 9: 110,980,939 Y348N probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Med25 A G 7: 44,884,622 S245P probably benign Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Naip6 T A 13: 100,299,428 E862D probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nyap2 T C 1: 81,191,887 S120P probably damaging Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pappa2 A T 1: 158,750,563 D1721E probably damaging Het
Pcid2 A T 8: 13,094,141 probably null Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rabggta A T 14: 55,721,189 F62L possibly damaging Het
Rasal3 G A 17: 32,396,350 Q505* probably null Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rpgrip1l T C 8: 91,232,924 D1116G probably benign Het
Rsph4a A T 10: 33,913,072 N638Y probably damaging Het
Scn9a A G 2: 66,566,250 F100L probably damaging Het
Siglece A G 7: 43,657,795 V256A probably benign Het
Slc23a2 A T 2: 132,056,766 L617Q probably damaging Het
Snx9 T C 17: 5,928,256 I567T possibly damaging Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Sugp2 T A 8: 70,253,660 I790K probably damaging Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tbl1xr1 T C 3: 22,190,910 probably benign Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Trim43c T A 9: 88,840,617 D105E probably benign Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Vmn2r18 T C 5: 151,575,821 N393D probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Other mutations in Irf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Irf4 APN 13 30751784 missense probably damaging 1.00
IGL01154:Irf4 APN 13 30757421 missense possibly damaging 0.46
IGL01669:Irf4 APN 13 30757471 missense probably damaging 0.99
IGL02729:Irf4 APN 13 30753591 critical splice donor site probably null
IGL03197:Irf4 APN 13 30763520 splice site probably benign
honey UTSW 13 30751751 missense probably damaging 0.99
Honey2 UTSW 13 30761490 splice site probably benign
miel UTSW 13 30761462 missense probably benign 0.00
R1300:Irf4 UTSW 13 30757585 missense probably damaging 0.98
R1656:Irf4 UTSW 13 30757502 missense probably benign
R1915:Irf4 UTSW 13 30761462 missense probably benign 0.00
R3889:Irf4 UTSW 13 30761490 splice site probably benign
R4648:Irf4 UTSW 13 30763597 missense probably benign 0.00
R5553:Irf4 UTSW 13 30751828 missense probably damaging 1.00
R5913:Irf4 UTSW 13 30757758 missense probably benign
R7809:Irf4 UTSW 13 30757432 missense probably benign 0.07
R7894:Irf4 UTSW 13 30753452 missense probably benign
R7977:Irf4 UTSW 13 30753452 missense probably benign
R8051:Irf4 UTSW 13 30761473 missense probably damaging 0.98
Z1177:Irf4 UTSW 13 30750661 missense probably damaging 0.98
Z1177:Irf4 UTSW 13 30750663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAGGGCTGGACTTAGGG -3'
(R):5'- TGTTCACTGGAGCCTGCTTC -3'

Sequencing Primer
(F):5'- AGCAGACTTCCACGTGACTCTG -3'
(R):5'- GGAGCCTGCTTCCTCCTG -3'
Posted On2014-07-14