Mutagenetix > Incidental Mutation

Incidental Mutation 'R1914:Snx9'

214723

Institutional Source

Beutler Lab

Gene Symbol

Snx9

Ensembl Gene

ENSMUSG00000002365

Gene Name

sorting nexin 9

Synonyms

SH3PX1, SDP1

MMRRC Submission

039932-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.881) question?

Stock #

R1914 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5841329-5931954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5928256 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 567 (I567T)

Ref Sequence

ENSEMBL: ENSMUSP00000002436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002436]

AlphaFold

Q91VH2

PDB Structure

Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002436
AA Change: I567T

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: I567T

Domain	Start	End	E-Value	Type
SH3	3	61	1.51e-16	SMART
low complexity region	84	100	N/A	INTRINSIC
low complexity region	160	170	N/A	INTRINSIC
PX	247	357	4.15e-23	SMART
Pfam:BAR_3_WASP_bdg	358	593	2.4e-120	PFAM

Meta Mutation Damage Score

0.4225

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.1%
20x: 91.6%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,485,850	V618E	possibly damaging	Het
Abca6	T	C	11: 110,212,210	R852G	probably benign	Het
Akap12	G	A	10: 4,356,685	R1165H	probably benign	Het
Asxl1	T	C	2: 153,401,906	S1459P	probably damaging	Het
Bahcc1	C	T	11: 120,285,399	R1957C	probably damaging	Het
Bcar1	A	G	8: 111,715,398	V270A	probably damaging	Het
Camsap3	C	T	8: 3,604,708	R782C	probably damaging	Het
Capn15	C	A	17: 25,964,863	A215S	probably benign	Het
Casz1	T	C	4: 148,932,958	F235L	probably damaging	Het
Ccdc57	A	T	11: 120,903,308		probably benign	Het
Cdh23	A	G	10: 60,323,570	V2142A	probably damaging	Het
Cdx1	A	G	18: 61,019,898	V212A	probably benign	Het
Cep104	T	C	4: 153,989,839	L516P	possibly damaging	Het
Cep95	C	T	11: 106,814,638	T483I	probably damaging	Het
Cfap100	T	C	6: 90,412,347		probably benign	Het
Chia1	T	A	3: 106,128,559	N238K	probably benign	Het
Cntrl	T	C	2: 35,162,861	M1126T	probably benign	Het
Col28a1	A	G	6: 8,176,333	F8S	probably benign	Het
Cpeb3	C	T	19: 37,054,265	R579Q	probably damaging	Het
Dbh	A	G	2: 27,168,222	D134G	probably damaging	Het
Diaph3	A	C	14: 86,656,485	N29K	probably damaging	Het
Dnajc2	A	G	5: 21,781,319		probably null	Het
Ephb1	C	T	9: 101,929,378	C819Y	probably damaging	Het
Eps8l2	G	A	7: 141,361,852	V650M	probably damaging	Het
Erlin1	T	C	19: 44,059,065	Y139C	probably damaging	Het
Fezf2	A	T	14: 12,343,988	V301E	probably damaging	Het
Fnbp4	T	C	2: 90,779,193		probably benign	Het
Gal3st4	T	A	5: 138,265,410	K442N	probably benign	Het
Gas6	T	C	8: 13,477,152	T199A	probably benign	Het
Gm10644	G	A	8: 83,933,850		probably benign	Het
Gpr88	G	T	3: 116,252,424	S79R	possibly damaging	Het
Grm4	A	T	17: 27,434,712	C755S	probably damaging	Het
Hdgfl2	A	G	17: 56,096,978	D278G	probably damaging	Het
Heatr5a	G	T	12: 51,905,467	A1130E	probably damaging	Het
Heatr9	T	G	11: 83,518,209	I171L	possibly damaging	Het
Hectd4	A	G	5: 121,322,294	T2209A	probably benign	Het
Hsh2d	A	G	8: 72,193,521	T21A	probably damaging	Het
Ing1	T	A	8: 11,561,577	V63E	probably damaging	Het
Irf4	A	T	13: 30,761,462	Q397L	probably benign	Het
Itgae	T	A	11: 73,118,643		probably benign	Het
Jrkl	A	T	9: 13,245,604	D17E	possibly damaging	Het
Kcnh6	T	A	11: 106,017,444	Y295*	probably null	Het
Klf5	T	C	14: 99,301,921	S177P	probably benign	Het
Lats1	T	A	10: 7,710,457		probably benign	Het
Lilrb4a	A	G	10: 51,491,949	I53M	probably benign	Het
Lrrc2	T	A	9: 110,980,939	Y348N	probably damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Med25	A	G	7: 44,884,622	S245P	probably benign	Het
Mlh3	T	C	12: 85,261,668	Y1115C	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myh10	T	C	11: 68,790,208	L1025P	probably damaging	Het
Myof	T	A	19: 37,977,693	N393I	probably damaging	Het
Naip6	T	A	13: 100,299,428	E862D	probably benign	Het
Ncald	C	T	15: 37,397,080	A119T	probably benign	Het
Nipbl	T	C	15: 8,343,630	E1044G	possibly damaging	Het
Nyap2	T	C	1: 81,191,887	S120P	probably damaging	Het
Oas1a	A	T	5: 120,905,813	N85K	possibly damaging	Het
Olfr870	T	C	9: 20,171,028	Y181C	probably benign	Het
Pappa2	A	T	1: 158,750,563	D1721E	probably damaging	Het
Pcid2	A	T	8: 13,094,141		probably null	Het
Pou2f2	C	T	7: 25,100,156	A92T	possibly damaging	Het
Ppp1r16a	T	C	15: 76,693,068	L212P	probably damaging	Het
Ptbp3	A	T	4: 59,517,635	L84Q	probably damaging	Het
Ptgr2	A	T	12: 84,302,322	Q145L	probably benign	Het
Pudp	T	C	18: 50,568,207	N152D	probably benign	Het
Rabggta	A	T	14: 55,721,189	F62L	possibly damaging	Het
Rasal3	G	A	17: 32,396,350	Q505*	probably null	Het
Rbm20	T	A	19: 53,864,087	L1166Q	probably damaging	Het
Rictor	T	G	15: 6,759,572	I223R	probably damaging	Het
Ripor1	A	T	8: 105,616,886	E270D	probably damaging	Het
Rorc	T	C	3: 94,391,173	C322R	probably damaging	Het
Rpgrip1l	T	C	8: 91,232,924	D1116G	probably benign	Het
Rsph4a	A	T	10: 33,913,072	N638Y	probably damaging	Het
Scn9a	A	G	2: 66,566,250	F100L	probably damaging	Het
Siglece	A	G	7: 43,657,795	V256A	probably benign	Het
Slc23a2	A	T	2: 132,056,766	L617Q	probably damaging	Het
Sptan1	C	G	2: 30,011,036	Q1425E	probably benign	Het
Srd5a3	G	A	5: 76,147,705	V81I	probably benign	Het
Sugp2	T	A	8: 70,253,660	I790K	probably damaging	Het
Syde2	T	G	3: 146,014,316	Y764*	probably null	Het
Tbl1xr1	T	C	3: 22,190,910		probably benign	Het
Tmem130	A	G	5: 144,737,856	F353S	probably damaging	Het
Tmem131	T	A	1: 36,796,266	K1591N	probably damaging	Het
Trim43c	T	A	9: 88,840,617	D105E	probably benign	Het
Urb2	C	A	8: 124,029,798	T748K	possibly damaging	Het
Vmn2r18	T	C	5: 151,575,821	N393D	probably benign	Het
Zfp292	G	A	4: 34,805,100	S2648F	possibly damaging	Het

Other mutations in Snx9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Snx9	APN	17	5899361	missense	probably benign
IGL00417:Snx9	APN	17	5891897	missense	probably benign	0.03
IGL01827:Snx9	APN	17	5887012	missense	probably benign	0.04
IGL02531:Snx9	APN	17	5891820	missense	probably benign
IGL02710:Snx9	APN	17	5908598	missense	probably damaging	1.00
IGL03088:Snx9	APN	17	5924610	missense	probably benign
san_angelo	UTSW	17	5891809	nonsense	probably null
PIT4495001:Snx9	UTSW	17	5920126	missense	possibly damaging	0.54
R0555:Snx9	UTSW	17	5918413	missense	probably damaging	0.97
R1015:Snx9	UTSW	17	5920127	missense	probably benign	0.12
R1065:Snx9	UTSW	17	5902361	splice site	probably benign
R1421:Snx9	UTSW	17	5902484	missense	probably benign	0.45
R1657:Snx9	UTSW	17	5918436	missense	possibly damaging	0.65
R1823:Snx9	UTSW	17	5920671	missense	probably damaging	1.00
R3703:Snx9	UTSW	17	5928200	splice site	probably null
R3871:Snx9	UTSW	17	5891781	missense	probably benign	0.00
R4375:Snx9	UTSW	17	5908626	nonsense	probably null
R4412:Snx9	UTSW	17	5908394	missense	probably damaging	0.96
R4669:Snx9	UTSW	17	5927224	missense	probably damaging	1.00
R4974:Snx9	UTSW	17	5902519	splice site	probably null
R5038:Snx9	UTSW	17	5887073	missense	probably benign	0.12
R5137:Snx9	UTSW	17	5928253	missense	probably damaging	1.00
R5369:Snx9	UTSW	17	5920580	missense	probably damaging	1.00
R5459:Snx9	UTSW	17	5920638	missense	probably damaging	0.99
R5624:Snx9	UTSW	17	5891809	nonsense	probably null
R5847:Snx9	UTSW	17	5924621	missense	possibly damaging	0.94
R5953:Snx9	UTSW	17	5908402	missense	probably damaging	1.00
R5953:Snx9	UTSW	17	5908403	missense	probably damaging	1.00
R6263:Snx9	UTSW	17	5887049	missense	probably damaging	0.98
R6481:Snx9	UTSW	17	5922209	critical splice donor site	probably null
R6491:Snx9	UTSW	17	5920162	missense	probably benign	0.00
R7873:Snx9	UTSW	17	5918476	missense	possibly damaging	0.81
R8471:Snx9	UTSW	17	5890090	missense	probably damaging	1.00
R9451:Snx9	UTSW	17	5899493	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCCTCTTAGAAGCAGCCAG -3'
(R):5'- TGTTGGGAGGGTACACTCACTG -3'

Sequencing Primer
(F):5'- CCAGATGAAGTCCTGCTGATGAC -3'
(R):5'- CTCACACCTGTGGATGGGGATG -3'

Posted On

2014-07-14