Incidental Mutation 'R1914:Mslnl'
ID214725
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Namemesothelin-like
Synonyms
MMRRC Submission 039932-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1914 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25736040-25748330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25742934 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 128 (V128M)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: V128M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: V128M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.2148 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (90/91)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,485,850 V618E possibly damaging Het
Abca6 T C 11: 110,212,210 R852G probably benign Het
Akap12 G A 10: 4,356,685 R1165H probably benign Het
Asxl1 T C 2: 153,401,906 S1459P probably damaging Het
Bahcc1 C T 11: 120,285,399 R1957C probably damaging Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Capn15 C A 17: 25,964,863 A215S probably benign Het
Casz1 T C 4: 148,932,958 F235L probably damaging Het
Ccdc57 A T 11: 120,903,308 probably benign Het
Cdh23 A G 10: 60,323,570 V2142A probably damaging Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep104 T C 4: 153,989,839 L516P possibly damaging Het
Cep95 C T 11: 106,814,638 T483I probably damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Diaph3 A C 14: 86,656,485 N29K probably damaging Het
Dnajc2 A G 5: 21,781,319 probably null Het
Ephb1 C T 9: 101,929,378 C819Y probably damaging Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Fezf2 A T 14: 12,343,988 V301E probably damaging Het
Fnbp4 T C 2: 90,779,193 probably benign Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gas6 T C 8: 13,477,152 T199A probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Grm4 A T 17: 27,434,712 C755S probably damaging Het
Hdgfl2 A G 17: 56,096,978 D278G probably damaging Het
Heatr5a G T 12: 51,905,467 A1130E probably damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Ing1 T A 8: 11,561,577 V63E probably damaging Het
Irf4 A T 13: 30,761,462 Q397L probably benign Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcnh6 T A 11: 106,017,444 Y295* probably null Het
Klf5 T C 14: 99,301,921 S177P probably benign Het
Lats1 T A 10: 7,710,457 probably benign Het
Lilrb4a A G 10: 51,491,949 I53M probably benign Het
Lrrc2 T A 9: 110,980,939 Y348N probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Med25 A G 7: 44,884,622 S245P probably benign Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Naip6 T A 13: 100,299,428 E862D probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nyap2 T C 1: 81,191,887 S120P probably damaging Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pappa2 A T 1: 158,750,563 D1721E probably damaging Het
Pcid2 A T 8: 13,094,141 probably null Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rabggta A T 14: 55,721,189 F62L possibly damaging Het
Rasal3 G A 17: 32,396,350 Q505* probably null Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rpgrip1l T C 8: 91,232,924 D1116G probably benign Het
Rsph4a A T 10: 33,913,072 N638Y probably damaging Het
Scn9a A G 2: 66,566,250 F100L probably damaging Het
Siglece A G 7: 43,657,795 V256A probably benign Het
Slc23a2 A T 2: 132,056,766 L617Q probably damaging Het
Snx9 T C 17: 5,928,256 I567T possibly damaging Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Sugp2 T A 8: 70,253,660 I790K probably damaging Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tbl1xr1 T C 3: 22,190,910 probably benign Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Trim43c T A 9: 88,840,617 D105E probably benign Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Vmn2r18 T C 5: 151,575,821 N393D probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
R7156:Mslnl UTSW 17 25743210 missense probably benign 0.20
R7467:Mslnl UTSW 17 25736921 start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25743183 missense probably damaging 0.97
R7807:Mslnl UTSW 17 25746777 missense probably benign 0.03
R8682:Mslnl UTSW 17 25746988 missense probably benign
R8735:Mslnl UTSW 17 25745088 missense probably benign 0.09
R8742:Mslnl UTSW 17 25745073 missense probably damaging 1.00
RF007:Mslnl UTSW 17 25743228 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCCATCAGAAGGGAGGTTTG -3'
(R):5'- AAGCCACAGGTCTGAAGCAC -3'

Sequencing Primer
(F):5'- TTTGAACCCAGGACTGAGGTGAC -3'
(R):5'- CACAGGTCTGAAGCACTGAGC -3'
Posted On2014-07-14