Incidental Mutation 'R1915:Sugp2'
ID214774
Institutional Source Beutler Lab
Gene Symbol Sugp2
Ensembl Gene ENSMUSG00000036054
Gene NameSURP and G patch domain containing 2
SynonymsSrsf14, Sfrs14
MMRRC Submission 039933-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R1915 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70234226-70279915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70253660 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 790 (I790K)
Ref Sequence ENSEMBL: ENSMUSP00000128029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093458] [ENSMUST00000131489] [ENSMUST00000164403]
Predicted Effect probably damaging
Transcript: ENSMUST00000093458
AA Change: I790K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091167
Gene: ENSMUSG00000036054
AA Change: I790K

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126239
SMART Domains Protein: ENSMUSP00000118748
Gene: ENSMUSG00000036054

DomainStartEndE-ValueType
low complexity region 36 65 N/A INTRINSIC
G_patch 171 217 1.13e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130492
Predicted Effect probably damaging
Transcript: ENSMUST00000131489
AA Change: I790K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114833
Gene: ENSMUSG00000036054
AA Change: I790K

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156330
Predicted Effect probably damaging
Transcript: ENSMUST00000164403
AA Change: I790K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128029
Gene: ENSMUSG00000036054
AA Change: I790K

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Meta Mutation Damage Score 0.6567 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arginine/serine-rich family of splicing factors. The encoded protein functions in mRNA processing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,210 R852G probably benign Het
Adam2 C A 14: 66,037,557 V576F possibly damaging Het
Afmid T C 11: 117,835,799 F250L possibly damaging Het
Apc2 A T 10: 80,315,867 I2252L probably benign Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Btnl7-ps T A 17: 34,541,645 noncoding transcript Het
Cdkn2aip T C 8: 47,711,926 T251A probably benign Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep95 C T 11: 106,814,638 T483I probably damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Cfap54 A G 10: 92,884,702 V2630A unknown Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cldn23 T A 8: 35,825,945 I130F possibly damaging Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Dcbld1 G T 10: 52,317,035 C292F probably damaging Het
Dlgap5 T C 14: 47,407,773 K304E probably benign Het
Dnajc2 A G 5: 21,781,319 probably null Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exoc3 A G 13: 74,173,294 probably null Het
F5 C A 1: 164,182,917 R406S probably damaging Het
Fahd1 A T 17: 24,849,648 W152R possibly damaging Het
Farp2 T A 1: 93,528,702 S36T probably benign Het
Foxs1 A G 2: 152,932,840 C98R probably damaging Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gm8674 A T 13: 49,900,853 noncoding transcript Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Irf4 A T 13: 30,761,462 Q397L probably benign Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcna4 T C 2: 107,296,778 V619A probably benign Het
Kcnh6 T A 11: 106,017,444 Y295* probably null Het
Kif1b G A 4: 149,267,216 T263I probably damaging Het
Large2 G T 2: 92,365,825 probably benign Het
Lcp1 T A 14: 75,199,297 Y28N possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mccc2 T C 13: 99,948,530 probably null Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Mlst8 C T 17: 24,477,290 W155* probably null Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Nalcn C T 14: 123,302,769 V1140I probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nupl1 T C 14: 60,238,531 K279R probably benign Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr738 C T 14: 50,414,341 P266S probably damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Pram1 A T 17: 33,641,157 I233F probably benign Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Ptpn23 A T 9: 110,386,507 D1396E probably damaging Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rpgrip1l T C 8: 91,232,924 D1116G probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Stk36 T A 1: 74,634,187 S1080T probably benign Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Uri1 A T 7: 37,961,678 I480K probably damaging Het
Zcchc3 A C 2: 152,413,681 V366G probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Zfp54 T C 17: 21,434,152 Y303H probably benign Het
Zfp729b A G 13: 67,593,220 F319L probably damaging Het
Zfp934 G A 13: 62,517,955 H291Y probably damaging Het
Other mutations in Sugp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Sugp2 APN 8 70242535 missense probably damaging 1.00
IGL01126:Sugp2 APN 8 70251874 missense probably damaging 1.00
IGL01154:Sugp2 APN 8 70242699 missense probably damaging 1.00
IGL02037:Sugp2 APN 8 70259674 splice site probably benign
IGL02401:Sugp2 APN 8 70243171 missense possibly damaging 0.75
IGL02738:Sugp2 APN 8 70243799 missense probably damaging 1.00
IGL03060:Sugp2 APN 8 70243187 missense possibly damaging 0.89
PIT4687001:Sugp2 UTSW 8 70257512 missense probably damaging 0.96
PIT4791001:Sugp2 UTSW 8 70260545 nonsense probably null
R0538:Sugp2 UTSW 8 70258948 missense probably damaging 1.00
R1459:Sugp2 UTSW 8 70244064 splice site probably benign
R1687:Sugp2 UTSW 8 70242634 missense probably damaging 1.00
R1801:Sugp2 UTSW 8 70236710 missense possibly damaging 0.86
R1914:Sugp2 UTSW 8 70253660 missense probably damaging 0.98
R2004:Sugp2 UTSW 8 70242656 unclassified probably null
R2012:Sugp2 UTSW 8 70243211 missense possibly damaging 0.78
R4584:Sugp2 UTSW 8 70251898 missense probably benign 0.13
R4791:Sugp2 UTSW 8 70242790 missense probably damaging 1.00
R4970:Sugp2 UTSW 8 70259812 missense possibly damaging 0.94
R5101:Sugp2 UTSW 8 70260489 missense probably damaging 1.00
R5240:Sugp2 UTSW 8 70243275 missense probably benign 0.00
R5279:Sugp2 UTSW 8 70257107 intron probably benign
R5303:Sugp2 UTSW 8 70242177 intron probably benign
R5966:Sugp2 UTSW 8 70252103 critical splice donor site probably null
R5988:Sugp2 UTSW 8 70243225 missense probably benign
R6615:Sugp2 UTSW 8 70242770 missense possibly damaging 0.92
R7382:Sugp2 UTSW 8 70242844 missense probably benign 0.02
R7803:Sugp2 UTSW 8 70252072 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGAGTGATGGCCTGTTCC -3'
(R):5'- GGGCAAGGCATTTCCTGATG -3'

Sequencing Primer
(F):5'- TGATGGCCTGTTCCCACACAG -3'
(R):5'- CAAGGCATTTCCTGATGATCTG -3'
Posted On2014-07-14