Incidental Mutation 'R1915:Creld2'
ID214812
Institutional Source Beutler Lab
Gene Symbol Creld2
Ensembl Gene ENSMUSG00000023272
Gene Namecysteine-rich with EGF-like domains 2
Synonyms
MMRRC Submission 039933-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1915 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location88819646-88826683 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 88820631 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 103 (W103*)
Ref Sequence ENSEMBL: ENSMUSP00000024042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024042] [ENSMUST00000043087] [ENSMUST00000159328] [ENSMUST00000162183]
Predicted Effect probably null
Transcript: ENSMUST00000024042
AA Change: W103*
SMART Domains Protein: ENSMUSP00000024042
Gene: ENSMUSG00000023272
AA Change: W103*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF3456 28 86 1.3e-7 PFAM
low complexity region 90 100 N/A INTRINSIC
EGF 137 176 3.76e-1 SMART
FU 191 238 1.2e-7 SMART
EGF_like 228 273 1.76e-3 SMART
FU 251 298 5.08e-6 SMART
EGF_CA 288 329 3.17e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043087
SMART Domains Protein: ENSMUSP00000043480
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 267 4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159328
SMART Domains Protein: ENSMUSP00000125534
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 169 6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160222
Predicted Effect probably benign
Transcript: ENSMUST00000162183
SMART Domains Protein: ENSMUSP00000123935
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 406 3.3e-44 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 100% (85/85)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,210 R852G probably benign Het
Adam2 C A 14: 66,037,557 V576F possibly damaging Het
Afmid T C 11: 117,835,799 F250L possibly damaging Het
Apc2 A T 10: 80,315,867 I2252L probably benign Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Btnl7-ps T A 17: 34,541,645 noncoding transcript Het
Cdkn2aip T C 8: 47,711,926 T251A probably benign Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep95 C T 11: 106,814,638 T483I probably damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Cfap54 A G 10: 92,884,702 V2630A unknown Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cldn23 T A 8: 35,825,945 I130F possibly damaging Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Dcbld1 G T 10: 52,317,035 C292F probably damaging Het
Dlgap5 T C 14: 47,407,773 K304E probably benign Het
Dnajc2 A G 5: 21,781,319 probably null Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exoc3 A G 13: 74,173,294 probably null Het
F5 C A 1: 164,182,917 R406S probably damaging Het
Fahd1 A T 17: 24,849,648 W152R possibly damaging Het
Farp2 T A 1: 93,528,702 S36T probably benign Het
Foxs1 A G 2: 152,932,840 C98R probably damaging Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gm8674 A T 13: 49,900,853 noncoding transcript Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Irf4 A T 13: 30,761,462 Q397L probably benign Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcna4 T C 2: 107,296,778 V619A probably benign Het
Kcnh6 T A 11: 106,017,444 Y295* probably null Het
Kif1b G A 4: 149,267,216 T263I probably damaging Het
Large2 G T 2: 92,365,825 probably benign Het
Lcp1 T A 14: 75,199,297 Y28N possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mccc2 T C 13: 99,948,530 probably null Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Mlst8 C T 17: 24,477,290 W155* probably null Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Nalcn C T 14: 123,302,769 V1140I probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nupl1 T C 14: 60,238,531 K279R probably benign Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr738 C T 14: 50,414,341 P266S probably damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Pram1 A T 17: 33,641,157 I233F probably benign Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Ptpn23 A T 9: 110,386,507 D1396E probably damaging Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rpgrip1l T C 8: 91,232,924 D1116G probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Stk36 T A 1: 74,634,187 S1080T probably benign Het
Sugp2 T A 8: 70,253,660 I790K probably damaging Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Uri1 A T 7: 37,961,678 I480K probably damaging Het
Zcchc3 A C 2: 152,413,681 V366G probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Zfp54 T C 17: 21,434,152 Y303H probably benign Het
Zfp729b A G 13: 67,593,220 F319L probably damaging Het
Zfp934 G A 13: 62,517,955 H291Y probably damaging Het
Other mutations in Creld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0510:Creld2 UTSW 15 88819956 missense probably damaging 1.00
R1137:Creld2 UTSW 15 88820631 nonsense probably null
R1163:Creld2 UTSW 15 88820631 nonsense probably null
R1164:Creld2 UTSW 15 88820631 nonsense probably null
R1206:Creld2 UTSW 15 88820631 nonsense probably null
R1207:Creld2 UTSW 15 88820631 nonsense probably null
R1207:Creld2 UTSW 15 88820631 nonsense probably null
R1457:Creld2 UTSW 15 88823753 missense probably damaging 1.00
R1475:Creld2 UTSW 15 88820631 nonsense probably null
R2105:Creld2 UTSW 15 88820631 nonsense probably null
R4297:Creld2 UTSW 15 88823753 missense probably damaging 1.00
R5843:Creld2 UTSW 15 88826429 missense probably damaging 1.00
R6066:Creld2 UTSW 15 88823766 missense possibly damaging 0.95
R6402:Creld2 UTSW 15 88823141 missense probably damaging 0.99
R6454:Creld2 UTSW 15 88823071 nonsense probably null
R6543:Creld2 UTSW 15 88825278 missense probably benign 0.00
R6808:Creld2 UTSW 15 88825210 missense probably damaging 1.00
R6912:Creld2 UTSW 15 88819997 missense probably damaging 1.00
R7342:Creld2 UTSW 15 88826407 missense probably benign 0.03
R8058:Creld2 UTSW 15 88826429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGTGAGCAGACTGGTGC -3'
(R):5'- AAGGACCTCAGGTGATTCGG -3'

Sequencing Primer
(F):5'- GCAGACTGGTGCTTTGGG -3'
(R):5'- CCCTCAAGGCTATGTGATGG -3'
Posted On2014-07-14