Mutagenetix > Incidental Mutation

Incidental Mutation 'R1916:Spen'

214847

Institutional Source

Beutler Lab

Gene Symbol

Spen

Ensembl Gene

ENSMUSG00000040761

Gene Name

spen family transcription repressor

Synonyms

Mint

MMRRC Submission

039934-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1916 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141467890-141538597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141472598 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 2883 (L2883P)

Ref Sequence

ENSEMBL: ENSMUSP00000077925 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000078886
AA Change: L2883P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: L2883P

Domain	Start	End	E-Value	Type
RRM	7	77	7.77e-12	SMART
low complexity region	109	121	N/A	INTRINSIC
low complexity region	235	257	N/A	INTRINSIC
low complexity region	262	311	N/A	INTRINSIC
RRM	338	411	8.6e-5	SMART
RRM	441	511	1.56e-16	SMART
RRM	520	587	1.84e-13	SMART
low complexity region	617	632	N/A	INTRINSIC
low complexity region	669	691	N/A	INTRINSIC
low complexity region	695	720	N/A	INTRINSIC
low complexity region	749	773	N/A	INTRINSIC
coiled coil region	800	825	N/A	INTRINSIC
low complexity region	830	841	N/A	INTRINSIC
internal_repeat_2	844	954	6.27e-5	PROSPERO
coiled coil region	1494	1522	N/A	INTRINSIC
low complexity region	1587	1627	N/A	INTRINSIC
low complexity region	1635	1641	N/A	INTRINSIC
low complexity region	1642	1671	N/A	INTRINSIC
low complexity region	1747	1758	N/A	INTRINSIC
low complexity region	1810	1823	N/A	INTRINSIC
low complexity region	1888	1903	N/A	INTRINSIC
low complexity region	1940	1955	N/A	INTRINSIC
low complexity region	2003	2012	N/A	INTRINSIC
internal_repeat_2	2015	2115	6.27e-5	PROSPERO
low complexity region	2127	2147	N/A	INTRINSIC
low complexity region	2169	2191	N/A	INTRINSIC
low complexity region	2207	2219	N/A	INTRINSIC
low complexity region	2304	2323	N/A	INTRINSIC
low complexity region	2332	2371	N/A	INTRINSIC
low complexity region	2396	2413	N/A	INTRINSIC
low complexity region	2518	2533	N/A	INTRINSIC
low complexity region	2545	2555	N/A	INTRINSIC
low complexity region	2696	2722	N/A	INTRINSIC
low complexity region	2931	2942	N/A	INTRINSIC
low complexity region	2994	3006	N/A	INTRINSIC
low complexity region	3192	3212	N/A	INTRINSIC
low complexity region	3299	3337	N/A	INTRINSIC
Pfam:SPOC	3465	3586	2.7e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000105786
AA Change: L2906P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: L2906P

Domain	Start	End	E-Value	Type
RRM	7	77	7.77e-12	SMART
low complexity region	109	121	N/A	INTRINSIC
low complexity region	235	257	N/A	INTRINSIC
low complexity region	262	311	N/A	INTRINSIC
RRM	338	411	8.6e-5	SMART
RRM	441	511	1.56e-16	SMART
RRM	520	587	1.84e-13	SMART
low complexity region	692	714	N/A	INTRINSIC
low complexity region	718	743	N/A	INTRINSIC
low complexity region	772	796	N/A	INTRINSIC
coiled coil region	823	848	N/A	INTRINSIC
low complexity region	853	864	N/A	INTRINSIC
internal_repeat_2	867	977	8.58e-5	PROSPERO
coiled coil region	1517	1545	N/A	INTRINSIC
low complexity region	1610	1650	N/A	INTRINSIC
low complexity region	1658	1664	N/A	INTRINSIC
low complexity region	1665	1694	N/A	INTRINSIC
low complexity region	1770	1781	N/A	INTRINSIC
low complexity region	1833	1846	N/A	INTRINSIC
low complexity region	1911	1926	N/A	INTRINSIC
low complexity region	1963	1978	N/A	INTRINSIC
low complexity region	2026	2035	N/A	INTRINSIC
internal_repeat_2	2038	2138	8.58e-5	PROSPERO
low complexity region	2150	2170	N/A	INTRINSIC
low complexity region	2192	2214	N/A	INTRINSIC
low complexity region	2230	2242	N/A	INTRINSIC
low complexity region	2327	2346	N/A	INTRINSIC
low complexity region	2355	2394	N/A	INTRINSIC
low complexity region	2419	2436	N/A	INTRINSIC
low complexity region	2541	2556	N/A	INTRINSIC
low complexity region	2568	2578	N/A	INTRINSIC
low complexity region	2719	2745	N/A	INTRINSIC
low complexity region	2954	2965	N/A	INTRINSIC
low complexity region	3017	3029	N/A	INTRINSIC
low complexity region	3215	3235	N/A	INTRINSIC
low complexity region	3322	3360	N/A	INTRINSIC
Pfam:SPOC	3488	3609	2.7e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142438

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147227

Meta Mutation Damage Score

0.5923

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 94.9%
20x: 91.5%

Validation Efficiency

99% (97/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	C	14: 49,768,475	T588A	probably damaging	Het
Abca13	G	T	11: 9,534,456	W4342L	probably damaging	Het
Abcg8	A	T	17: 84,688,530		probably null	Het
Acaa1b	A	G	9: 119,156,662	L65P	probably damaging	Het
Adam6a	G	T	12: 113,545,936	R643L	probably benign	Het
Agbl2	A	T	2: 90,815,441	R839S	possibly damaging	Het
Ambra1	A	T	2: 91,911,461	N967I	probably damaging	Het
Ankrd17	T	A	5: 90,260,141	N1406Y	probably damaging	Het
Bbx	G	T	16: 50,266,245	S96Y	probably damaging	Het
Casc1	A	C	6: 145,176,200	V631G	probably benign	Het
Cdh12	T	A	15: 21,520,250		probably null	Het
Cdh9	A	C	15: 16,823,275	R114S	probably benign	Het
Cenpo	T	G	12: 4,216,683	I142L	probably benign	Het
Cfap69	T	C	5: 5,663,970	K21E	probably damaging	Het
Chmp4c	A	T	3: 10,389,936	D221V	probably benign	Het
Cstf3	T	A	2: 104,655,756	V447D	possibly damaging	Het
Cwc22	A	T	2: 77,905,475	C566S	probably benign	Het
Dgkh	A	G	14: 78,595,223	M798T	probably damaging	Het
Dnaic2	T	C	11: 114,732,923	V4A	possibly damaging	Het
Dnmbp	T	G	19: 43,901,568	I587L	possibly damaging	Het
Dock6	A	T	9: 21,813,091	M301K	probably damaging	Het
Dock8	T	C	19: 25,061,157	M69T	probably benign	Het
Ears2	T	C	7: 122,044,578	S386G	probably benign	Het
Ecsit	T	C	9: 22,072,521	I371V	probably benign	Het
Eif4a3	T	C	11: 119,293,911	I216V	probably benign	Het
Emp1	A	G	6: 135,380,130	I69V	probably damaging	Het
Epg5	A	G	18: 77,965,021	D788G	probably benign	Het
Eps15	A	G	4: 109,368,974	K324E	probably damaging	Het
Extl3	A	G	14: 65,077,622	F37S	probably benign	Het
Fam83g	A	G	11: 61,695,168	D194G	probably damaging	Het
Gcc2	A	G	10: 58,276,663	D1005G	probably damaging	Het
Gm10226	T	A	17: 21,692,009	H50Q	possibly damaging	Het
Gm1110	A	T	9: 26,889,638	V420E	probably damaging	Het
Gm16503	A	G	4: 147,541,210	R54G	unknown	Het
Gm5538	A	G	3: 59,745,503	K121R	possibly damaging	Het
Grasp	T	C	15: 101,226,969		probably benign	Het
Grin3b	T	C	10: 79,974,598	M646T	probably damaging	Het
Grm8	T	C	6: 27,363,584	D644G	probably benign	Het
Gtf2i	C	A	5: 134,246,848	V660F	probably damaging	Het
Heatr4	G	T	12: 83,955,817	Q808K	probably benign	Het
Hif3a	T	C	7: 17,039,656	S573G	possibly damaging	Het
Htr2b	C	T	1: 86,099,801	V328M	probably damaging	Het
Jph1	T	C	1: 17,092,055	T128A	probably damaging	Het
Kcnt1	T	C	2: 25,900,469	V481A	probably damaging	Het
Khk	A	G	5: 30,930,618	Y212C	probably damaging	Het
Lgi2	T	A	5: 52,546,632	Q219L	probably benign	Het
Lipf	T	A	19: 33,965,675	Y128N	probably benign	Het
Lipg	A	G	18: 74,960,937	V13A	probably benign	Het
Lrrc8e	T	C	8: 4,235,202	S476P	probably benign	Het
Map2k7	T	G	8: 4,245,795	V425G	probably benign	Het
Mycbp2	A	T	14: 103,184,883	S2451R	probably damaging	Het
Mylk3	A	G	8: 85,327,192	S629P	probably damaging	Het
Nrp2	A	T	1: 62,762,747	I450F	probably damaging	Het
Olfr1261	T	C	2: 89,993,804	V137A	probably benign	Het
Olfr150	A	G	9: 39,737,622	D269G	probably benign	Het
Osbpl11	T	C	16: 33,185,843	S14P	probably benign	Het
Osbpl11	T	A	16: 33,210,095	V231D	possibly damaging	Het
Parg	T	A	14: 32,208,227		probably benign	Het
Pax9	G	T	12: 56,697,138	R190L	possibly damaging	Het
Prss12	G	A	3: 123,506,495	V752I	probably benign	Het
Pstpip2	A	G	18: 77,835,192	N34S	probably damaging	Het
Rarg	T	C	15: 102,252,445	D53G	probably benign	Het
Rbak	T	C	5: 143,176,116	K53R	probably damaging	Het
Scgn	A	T	13: 23,978,825	S107R	probably damaging	Het
Sema3c	A	G	5: 17,727,401	Q634R	probably benign	Het
Serpinh1	A	G	7: 99,349,081	L114P	probably damaging	Het
Slc35f4	T	C	14: 49,303,923		probably benign	Het
Sned1	A	T	1: 93,274,162	I617F	probably null	Het
Spata31	C	T	13: 64,922,545	R836*	probably null	Het
Stmn3	A	T	2: 181,307,280	M140K	possibly damaging	Het
Syn3	A	G	10: 86,354,344		probably null	Het
Tor4a	A	G	2: 25,195,402	V163A	possibly damaging	Het
Ttc12	A	G	9: 49,460,398	Y189H	probably damaging	Het
Ubxn7	T	G	16: 32,381,759		probably benign	Het
Unc5b	G	A	10: 60,778,248	T274I	probably damaging	Het
Upk1b	C	A	16: 38,776,186		probably null	Het
Usp18	A	G	6: 121,268,554	I296M	probably benign	Het
Usp42	A	G	5: 143,715,056	Y1071H	probably damaging	Het
Vil1	A	G	1: 74,418,525	T106A	probably benign	Het
Vmn1r42	T	A	6: 89,844,967	I207F	probably benign	Het
Vmn1r63	A	G	7: 5,803,226	F136L	probably damaging	Het
Vopp1	C	T	6: 57,754,587	V140I	probably benign	Het
Wdhd1	T	C	14: 47,258,577	D610G	possibly damaging	Het
Wdr48	T	A	9: 119,912,417	D142E	probably benign	Het
Whrn	A	G	4: 63,494,732	Y10H	probably damaging	Het
Zmat3	A	G	3: 32,343,348	V216A	probably benign	Het
Zmym2	C	T	14: 56,959,842	R1356W	probably damaging	Het
Zyg11b	A	T	4: 108,272,283	L44Q	probably damaging	Het

Other mutations in Spen

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Spen	APN	4	141489901	missense	unknown
IGL01357:Spen	APN	4	141517113	missense	unknown
IGL02184:Spen	APN	4	141487606	missense	unknown
IGL02226:Spen	APN	4	141478146	missense	unknown
IGL02321:Spen	APN	4	141517130	missense	unknown
IGL02350:Spen	APN	4	141477579	missense	unknown
IGL02357:Spen	APN	4	141477579	missense	unknown
IGL02627:Spen	APN	4	141473015	missense	probably damaging	0.99
IGL02683:Spen	APN	4	141471645	missense	probably benign	0.06
IGL02945:Spen	APN	4	141494313	missense	unknown
IGL02950:Spen	APN	4	141469508	missense	probably damaging	1.00
IGL03008:Spen	APN	4	141476137	missense	possibly damaging	0.70
IGL03019:Spen	APN	4	141478916	missense	unknown
IGL03038:Spen	APN	4	141538239	missense	unknown
IGL03334:Spen	APN	4	141469969	missense	probably damaging	1.00
filtered	UTSW	4	141477372	missense	unknown
mentholated	UTSW	4	141469400	missense	possibly damaging	0.78
R0105:Spen	UTSW	4	141469810	splice site	probably benign
R0268:Spen	UTSW	4	141477557	missense	unknown
R0359:Spen	UTSW	4	141516870	missense	unknown
R0394:Spen	UTSW	4	141474203	missense	probably benign	0.03
R0423:Spen	UTSW	4	141479336	missense	unknown
R0433:Spen	UTSW	4	141483758	missense	unknown
R0462:Spen	UTSW	4	141473651	missense	probably damaging	1.00
R0687:Spen	UTSW	4	141488028	missense	unknown
R0699:Spen	UTSW	4	141474391	missense	possibly damaging	0.72
R0865:Spen	UTSW	4	141471870	missense	probably benign	0.11
R0918:Spen	UTSW	4	141485564	missense	unknown
R1034:Spen	UTSW	4	141475752	missense	probably benign	0.33
R1341:Spen	UTSW	4	141469400	missense	possibly damaging	0.78
R1401:Spen	UTSW	4	141471821	missense	probably damaging	0.98
R1509:Spen	UTSW	4	141475635	missense	probably benign	0.00
R1509:Spen	UTSW	4	141475700	missense	possibly damaging	0.53
R1561:Spen	UTSW	4	141472383	nonsense	probably null
R1589:Spen	UTSW	4	141488024	missense	unknown
R1640:Spen	UTSW	4	141468943	missense	probably damaging	0.98
R1758:Spen	UTSW	4	141476375	missense	unknown
R1764:Spen	UTSW	4	141472950	missense	probably damaging	1.00
R1824:Spen	UTSW	4	141472785	missense	probably damaging	1.00
R1899:Spen	UTSW	4	141470343	missense	probably benign	0.17
R2011:Spen	UTSW	4	141473329	missense	probably damaging	1.00
R2295:Spen	UTSW	4	141477273	missense	unknown
R2379:Spen	UTSW	4	141516927	missense	unknown
R2404:Spen	UTSW	4	141477905	missense	unknown
R3719:Spen	UTSW	4	141517183	missense	unknown
R3889:Spen	UTSW	4	141477881	missense	unknown
R3945:Spen	UTSW	4	141477353	missense	unknown
R4227:Spen	UTSW	4	141522147	missense	unknown
R4326:Spen	UTSW	4	141477372	missense	unknown
R4382:Spen	UTSW	4	141473139	missense	possibly damaging	0.88
R4542:Spen	UTSW	4	141476786	missense	unknown
R4757:Spen	UTSW	4	141473079	nonsense	probably null
R4771:Spen	UTSW	4	141472596	missense	probably benign	0.14
R5072:Spen	UTSW	4	141522302	missense	unknown
R5121:Spen	UTSW	4	141476099	missense	probably benign	0.00
R5176:Spen	UTSW	4	141476276	missense	unknown
R5290:Spen	UTSW	4	141473816	missense	probably damaging	1.00
R5291:Spen	UTSW	4	141488079	missense	unknown
R5293:Spen	UTSW	4	141472406	missense	possibly damaging	0.89
R5347:Spen	UTSW	4	141471485	missense	probably benign	0.26
R5511:Spen	UTSW	4	141475064	missense	possibly damaging	0.86
R5511:Spen	UTSW	4	141516838	missense	unknown
R5772:Spen	UTSW	4	141478184	missense	unknown
R5834:Spen	UTSW	4	141471843	missense	possibly damaging	0.63
R5858:Spen	UTSW	4	141473871	missense	probably benign	0.05
R6214:Spen	UTSW	4	141479112	missense	unknown
R6232:Spen	UTSW	4	141517022	missense	unknown
R6345:Spen	UTSW	4	141471633	missense	possibly damaging	0.86
R6419:Spen	UTSW	4	141476310	missense	unknown
R6455:Spen	UTSW	4	141475509	missense	probably damaging	0.97
R6979:Spen	UTSW	4	141478063	missense	unknown
R6994:Spen	UTSW	4	141493459	missense	unknown
R7018:Spen	UTSW	4	141493444	missense	unknown
R7040:Spen	UTSW	4	141494382	missense	unknown
R7127:Spen	UTSW	4	141476108	missense	possibly damaging	0.53
R7218:Spen	UTSW	4	141472650	missense	possibly damaging	0.54
R7234:Spen	UTSW	4	141479135	missense	unknown
R7316:Spen	UTSW	4	141477054	missense	unknown
R7350:Spen	UTSW	4	141479385	missense	unknown
R7356:Spen	UTSW	4	141471924	nonsense	probably null
R7400:Spen	UTSW	4	141473741	missense	probably damaging	1.00
R7470:Spen	UTSW	4	141479294	missense	unknown
R7698:Spen	UTSW	4	141472845	missense	probably damaging	1.00
R7858:Spen	UTSW	4	141488131	splice site	probably null
R8033:Spen	UTSW	4	141471746	missense	probably benign	0.03
R8064:Spen	UTSW	4	141475700	missense	possibly damaging	0.53
R8159:Spen	UTSW	4	141475003	missense	possibly damaging	0.53
R8187:Spen	UTSW	4	141472905	missense	possibly damaging	0.93
R8463:Spen	UTSW	4	141522279	missense	unknown
R8557:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8558:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8672:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8673:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8674:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8714:Spen	UTSW	4	141488003	missense	unknown
R8735:Spen	UTSW	4	141469818	missense	probably benign	0.32
R8762:Spen	UTSW	4	141472950	missense	probably damaging	1.00
R8877:Spen	UTSW	4	141471826	nonsense	probably null
R8878:Spen	UTSW	4	141477209	missense	unknown
R8937:Spen	UTSW	4	141474063	missense	probably damaging	1.00
R8939:Spen	UTSW	4	141475658	missense	possibly damaging	0.72
R8968:Spen	UTSW	4	141470390	missense	probably benign	0.02
R8971:Spen	UTSW	4	141474578	missense	possibly damaging	0.53
R9016:Spen	UTSW	4	141473627	missense	probably damaging	1.00
R9072:Spen	UTSW	4	141476391	missense	unknown
R9073:Spen	UTSW	4	141476391	missense	unknown
R9120:Spen	UTSW	4	141472922	missense
R9136:Spen	UTSW	4	141522312	missense	unknown
R9138:Spen	UTSW	4	141469486	missense	probably damaging	1.00
R9150:Spen	UTSW	4	141517157	missense	unknown
R9225:Spen	UTSW	4	141475632	missense	possibly damaging	0.53
R9492:Spen	UTSW	4	141471787	missense	probably benign	0.26
R9537:Spen	UTSW	4	141471704	missense	probably benign	0.15
R9537:Spen	UTSW	4	141516845	small deletion	probably benign
R9602:Spen	UTSW	4	141477872	missense	unknown
R9609:Spen	UTSW	4	141488108	missense	unknown
R9686:Spen	UTSW	4	141472635	missense	probably benign	0.27
R9697:Spen	UTSW	4	141468964	missense	probably damaging	1.00
R9713:Spen	UTSW	4	141517020	missense	unknown
T0722:Spen	UTSW	4	141474353	missense	probably benign	0.33
T0975:Spen	UTSW	4	141474353	missense	probably benign	0.33
Z1088:Spen	UTSW	4	141477976	missense	unknown
Z1088:Spen	UTSW	4	141477977	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTCACCTCTGCAGGCAGTTTG -3'
(R):5'- GTCCCAAGTGAAAGCAGACTCC -3'

Sequencing Primer
(F):5'- CAGGCAGTTTGCTGGGCAG -3'
(R):5'- GTCTGCACCCAAAGGCC -3'

Posted On

2014-07-14