Incidental Mutation 'R1916:Dnai7'
ID 214862
Institutional Source Beutler Lab
Gene Symbol Dnai7
Ensembl Gene ENSMUSG00000043541
Gene Name dynein axonemal intermediate chain 7
Synonyms Las1, A230084G12Rik, Casc1
MMRRC Submission 039934-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R1916 (G1)
Quality Score 223
Status Validated
Chromosome 6
Chromosomal Location 145120560-145156731 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 145121926 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 631 (V631G)
Ref Sequence ENSEMBL: ENSMUSP00000144783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032396
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060797
AA Change: V631G

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: V631G

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111727
Predicted Effect probably benign
Transcript: ENSMUST00000111728
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132937
Predicted Effect probably benign
Transcript: ENSMUST00000132948
SMART Domains Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 8 504 3.7e-248 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135191
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect probably benign
Transcript: ENSMUST00000204105
AA Change: V631G

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541
AA Change: V631G

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency 99% (97/98)
MGI Phenotype PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm2 A G 3: 59,652,924 (GRCm39) K121R possibly damaging Het
Abca13 G T 11: 9,484,456 (GRCm39) W4342L probably damaging Het
Abcg8 A T 17: 84,995,958 (GRCm39) probably null Het
Acaa1b A G 9: 118,985,730 (GRCm39) L65P probably damaging Het
Adam6a G T 12: 113,509,556 (GRCm39) R643L probably benign Het
Agbl2 A T 2: 90,645,785 (GRCm39) R839S possibly damaging Het
Ambra1 A T 2: 91,741,806 (GRCm39) N967I probably damaging Het
Ankrd17 T A 5: 90,408,000 (GRCm39) N1406Y probably damaging Het
Armh4 T C 14: 50,005,932 (GRCm39) T588A probably damaging Het
Bbx G T 16: 50,086,608 (GRCm39) S96Y probably damaging Het
Cdh12 T A 15: 21,520,336 (GRCm39) probably null Het
Cdh9 A C 15: 16,823,361 (GRCm39) R114S probably benign Het
Cenpo T G 12: 4,266,683 (GRCm39) I142L probably benign Het
Cfap69 T C 5: 5,713,970 (GRCm39) K21E probably damaging Het
Chmp4c A T 3: 10,454,996 (GRCm39) D221V probably benign Het
Cstf3 T A 2: 104,486,101 (GRCm39) V447D possibly damaging Het
Cwc22 A T 2: 77,735,819 (GRCm39) C566S probably benign Het
Dgkh A G 14: 78,832,663 (GRCm39) M798T probably damaging Het
Dnai2 T C 11: 114,623,749 (GRCm39) V4A possibly damaging Het
Dnmbp T G 19: 43,890,007 (GRCm39) I587L possibly damaging Het
Dock6 A T 9: 21,724,387 (GRCm39) M301K probably damaging Het
Dock8 T C 19: 25,038,521 (GRCm39) M69T probably benign Het
Ears2 T C 7: 121,643,801 (GRCm39) S386G probably benign Het
Ecsit T C 9: 21,983,817 (GRCm39) I371V probably benign Het
Eif4a3 T C 11: 119,184,737 (GRCm39) I216V probably benign Het
Emp1 A G 6: 135,357,128 (GRCm39) I69V probably damaging Het
Epg5 A G 18: 78,008,236 (GRCm39) D788G probably benign Het
Eps15 A G 4: 109,226,171 (GRCm39) K324E probably damaging Het
Extl3 A G 14: 65,315,071 (GRCm39) F37S probably benign Het
Fam83g A G 11: 61,585,994 (GRCm39) D194G probably damaging Het
Gcc2 A G 10: 58,112,485 (GRCm39) D1005G probably damaging Het
Gm10226 T A 17: 21,910,916 (GRCm39) H50Q possibly damaging Het
Gm1110 A T 9: 26,800,934 (GRCm39) V420E probably damaging Het
Gm16503 A G 4: 147,625,667 (GRCm39) R54G unknown Het
Grin3b T C 10: 79,810,432 (GRCm39) M646T probably damaging Het
Grm8 T C 6: 27,363,583 (GRCm39) D644G probably benign Het
Gtf2i C A 5: 134,275,702 (GRCm39) V660F probably damaging Het
Heatr4 G T 12: 84,002,591 (GRCm39) Q808K probably benign Het
Hif3a T C 7: 16,773,581 (GRCm39) S573G possibly damaging Het
Htr2b C T 1: 86,027,523 (GRCm39) V328M probably damaging Het
Jph1 T C 1: 17,162,279 (GRCm39) T128A probably damaging Het
Kcnt1 T C 2: 25,790,481 (GRCm39) V481A probably damaging Het
Khk A G 5: 31,087,962 (GRCm39) Y212C probably damaging Het
Lgi2 T A 5: 52,703,974 (GRCm39) Q219L probably benign Het
Lipf T A 19: 33,943,075 (GRCm39) Y128N probably benign Het
Lipg A G 18: 75,094,008 (GRCm39) V13A probably benign Het
Lrrc8e T C 8: 4,285,202 (GRCm39) S476P probably benign Het
Map2k7 T G 8: 4,295,795 (GRCm39) V425G probably benign Het
Mycbp2 A T 14: 103,422,319 (GRCm39) S2451R probably damaging Het
Mylk3 A G 8: 86,053,821 (GRCm39) S629P probably damaging Het
Nrp2 A T 1: 62,801,906 (GRCm39) I450F probably damaging Het
Or4c126 T C 2: 89,824,148 (GRCm39) V137A probably benign Het
Or8g50 A G 9: 39,648,918 (GRCm39) D269G probably benign Het
Osbpl11 T C 16: 33,006,213 (GRCm39) S14P probably benign Het
Osbpl11 T A 16: 33,030,465 (GRCm39) V231D possibly damaging Het
Parg T A 14: 31,930,184 (GRCm39) probably benign Het
Pax9 G T 12: 56,743,923 (GRCm39) R190L possibly damaging Het
Prss12 G A 3: 123,300,144 (GRCm39) V752I probably benign Het
Pstpip2 A G 18: 77,922,892 (GRCm39) N34S probably damaging Het
Rarg T C 15: 102,160,880 (GRCm39) D53G probably benign Het
Rbak T C 5: 143,161,871 (GRCm39) K53R probably damaging Het
Scgn A T 13: 24,162,808 (GRCm39) S107R probably damaging Het
Sema3c A G 5: 17,932,399 (GRCm39) Q634R probably benign Het
Serpinh1 A G 7: 98,998,288 (GRCm39) L114P probably damaging Het
Slc35f4 T C 14: 49,541,380 (GRCm39) probably benign Het
Sned1 A T 1: 93,201,884 (GRCm39) I617F probably null Het
Spata31 C T 13: 65,070,359 (GRCm39) R836* probably null Het
Spen A G 4: 141,199,909 (GRCm39) L2883P probably damaging Het
Stmn3 A T 2: 180,949,073 (GRCm39) M140K possibly damaging Het
Syn3 A G 10: 86,190,208 (GRCm39) probably null Het
Tamalin T C 15: 101,124,850 (GRCm39) probably benign Het
Tor4a A G 2: 25,085,414 (GRCm39) V163A possibly damaging Het
Ttc12 A G 9: 49,371,698 (GRCm39) Y189H probably damaging Het
Ubxn7 T G 16: 32,200,577 (GRCm39) probably benign Het
Unc5b G A 10: 60,614,027 (GRCm39) T274I probably damaging Het
Upk1b C A 16: 38,596,548 (GRCm39) probably null Het
Usp18 A G 6: 121,245,513 (GRCm39) I296M probably benign Het
Usp42 A G 5: 143,700,811 (GRCm39) Y1071H probably damaging Het
Vil1 A G 1: 74,457,684 (GRCm39) T106A probably benign Het
Vmn1r42 T A 6: 89,821,949 (GRCm39) I207F probably benign Het
Vmn1r63 A G 7: 5,806,225 (GRCm39) F136L probably damaging Het
Vopp1 C T 6: 57,731,572 (GRCm39) V140I probably benign Het
Wdhd1 T C 14: 47,496,034 (GRCm39) D610G possibly damaging Het
Wdr48 T A 9: 119,741,483 (GRCm39) D142E probably benign Het
Whrn A G 4: 63,412,969 (GRCm39) Y10H probably damaging Het
Zmat3 A G 3: 32,397,497 (GRCm39) V216A probably benign Het
Zmym2 C T 14: 57,197,299 (GRCm39) R1356W probably damaging Het
Zyg11b A T 4: 108,129,480 (GRCm39) L44Q probably damaging Het
Other mutations in Dnai7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dnai7 APN 6 145,121,016 (GRCm39) missense probably benign 0.00
IGL00586:Dnai7 APN 6 145,137,302 (GRCm39) missense possibly damaging 0.53
IGL01066:Dnai7 APN 6 145,121,948 (GRCm39) missense probably damaging 0.96
IGL01413:Dnai7 APN 6 145,120,812 (GRCm39) missense probably damaging 1.00
IGL02275:Dnai7 APN 6 145,123,090 (GRCm39) missense probably damaging 1.00
IGL02668:Dnai7 APN 6 145,150,983 (GRCm39) missense unknown
IGL03018:Dnai7 APN 6 145,129,031 (GRCm39) missense probably damaging 1.00
IGL03233:Dnai7 APN 6 145,127,611 (GRCm39) missense probably damaging 1.00
R0011:Dnai7 UTSW 6 145,124,781 (GRCm39) missense probably damaging 1.00
R0011:Dnai7 UTSW 6 145,124,781 (GRCm39) missense probably damaging 1.00
R0180:Dnai7 UTSW 6 145,128,944 (GRCm39) critical splice donor site probably benign
R0786:Dnai7 UTSW 6 145,127,483 (GRCm39) critical splice donor site probably null
R2117:Dnai7 UTSW 6 145,150,967 (GRCm39) critical splice donor site probably null
R2174:Dnai7 UTSW 6 145,120,896 (GRCm39) missense probably damaging 1.00
R2264:Dnai7 UTSW 6 145,154,155 (GRCm39) utr 5 prime probably benign
R4393:Dnai7 UTSW 6 145,140,304 (GRCm39) missense possibly damaging 0.49
R4467:Dnai7 UTSW 6 145,128,944 (GRCm39) critical splice donor site probably null
R4847:Dnai7 UTSW 6 145,120,911 (GRCm39) missense probably damaging 1.00
R5014:Dnai7 UTSW 6 145,128,992 (GRCm39) missense probably damaging 1.00
R5207:Dnai7 UTSW 6 145,124,794 (GRCm39) missense probably damaging 1.00
R5264:Dnai7 UTSW 6 145,127,502 (GRCm39) missense probably benign 0.02
R5359:Dnai7 UTSW 6 145,142,618 (GRCm39) missense probably damaging 1.00
R5499:Dnai7 UTSW 6 145,123,157 (GRCm39) missense probably damaging 1.00
R6211:Dnai7 UTSW 6 145,146,217 (GRCm39) missense probably damaging 1.00
R6579:Dnai7 UTSW 6 145,124,744 (GRCm39) missense probably benign 0.19
R6939:Dnai7 UTSW 6 145,120,945 (GRCm39) missense possibly damaging 0.46
R7108:Dnai7 UTSW 6 145,131,591 (GRCm39) nonsense probably null
R7131:Dnai7 UTSW 6 145,123,132 (GRCm39) missense probably null 0.97
R7810:Dnai7 UTSW 6 145,140,312 (GRCm39) missense probably benign 0.28
R8017:Dnai7 UTSW 6 145,140,283 (GRCm39) missense probably damaging 1.00
R8385:Dnai7 UTSW 6 145,120,918 (GRCm39) missense probably damaging 1.00
R8680:Dnai7 UTSW 6 145,127,542 (GRCm39) missense probably benign 0.13
R8720:Dnai7 UTSW 6 145,150,983 (GRCm39) missense unknown
R9118:Dnai7 UTSW 6 145,120,971 (GRCm39) missense probably damaging 1.00
R9118:Dnai7 UTSW 6 145,120,900 (GRCm39) missense probably damaging 1.00
R9172:Dnai7 UTSW 6 145,123,175 (GRCm39) missense probably benign
R9290:Dnai7 UTSW 6 145,148,688 (GRCm39) missense unknown
X0063:Dnai7 UTSW 6 145,120,997 (GRCm39) missense probably benign 0.13
Z1176:Dnai7 UTSW 6 145,151,019 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCACTATAGTGGTGAAGGTC -3'
(R):5'- TGAGAGTAGAGCCACAGAATCC -3'

Sequencing Primer
(F):5'- AGGTCTGAGAGGCTAGAACTC -3'
(R):5'- GAGTAGAGCCACAGAATCCGATTTC -3'
Posted On 2014-07-14