Incidental Mutation 'R1916:Hif3a'
ID214864
Institutional Source Beutler Lab
Gene Symbol Hif3a
Ensembl Gene ENSMUSG00000004328
Gene Namehypoxia inducible factor 3, alpha subunit
SynonymsMOP7, Nepas, bHLHe17
MMRRC Submission 039934-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R1916 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location17031507-17062427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17039656 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 573 (S573G)
Ref Sequence ENSEMBL: ENSMUSP00000104132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037762] [ENSMUST00000108492]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037762
AA Change: S571G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048248
Gene: ENSMUSG00000004328
AA Change: S571G

DomainStartEndE-ValueType
HLH 18 73 1.57e-7 SMART
PAS 82 148 9.83e-10 SMART
PAS 225 293 2.72e-3 SMART
PAC 299 342 2.18e-2 SMART
low complexity region 421 437 N/A INTRINSIC
Pfam:HIF-1 472 505 1.8e-18 PFAM
low complexity region 508 520 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108492
AA Change: S573G

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104132
Gene: ENSMUSG00000004328
AA Change: S573G

DomainStartEndE-ValueType
HLH 20 75 1.57e-7 SMART
PAS 84 150 9.83e-10 SMART
PAS 227 295 2.72e-3 SMART
PAC 301 344 2.18e-2 SMART
low complexity region 423 439 N/A INTRINSIC
Pfam:HIF-1 475 506 5.7e-18 PFAM
low complexity region 510 522 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha-3 subunit of one of several alpha/beta-subunit heterodimeric transcription factors that regulate many adaptive responses to low oxygen tension (hypoxia). The alpha-3 subunit lacks the transactivation domain found in factors containing either the alpha-1 or alpha-2 subunits. It is thought that factors containing the alpha-3 subunit are negative regulators of hypoxia-inducible gene expression. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired lung remodeling resulting in hypertrophy of the heart right ventricle and pulmonary hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,768,475 T588A probably damaging Het
Abca13 G T 11: 9,534,456 W4342L probably damaging Het
Abcg8 A T 17: 84,688,530 probably null Het
Acaa1b A G 9: 119,156,662 L65P probably damaging Het
Adam6a G T 12: 113,545,936 R643L probably benign Het
Agbl2 A T 2: 90,815,441 R839S possibly damaging Het
Ambra1 A T 2: 91,911,461 N967I probably damaging Het
Ankrd17 T A 5: 90,260,141 N1406Y probably damaging Het
Bbx G T 16: 50,266,245 S96Y probably damaging Het
Casc1 A C 6: 145,176,200 V631G probably benign Het
Cdh12 T A 15: 21,520,250 probably null Het
Cdh9 A C 15: 16,823,275 R114S probably benign Het
Cenpo T G 12: 4,216,683 I142L probably benign Het
Cfap69 T C 5: 5,663,970 K21E probably damaging Het
Chmp4c A T 3: 10,389,936 D221V probably benign Het
Cstf3 T A 2: 104,655,756 V447D possibly damaging Het
Cwc22 A T 2: 77,905,475 C566S probably benign Het
Dgkh A G 14: 78,595,223 M798T probably damaging Het
Dnaic2 T C 11: 114,732,923 V4A possibly damaging Het
Dnmbp T G 19: 43,901,568 I587L possibly damaging Het
Dock6 A T 9: 21,813,091 M301K probably damaging Het
Dock8 T C 19: 25,061,157 M69T probably benign Het
Ears2 T C 7: 122,044,578 S386G probably benign Het
Ecsit T C 9: 22,072,521 I371V probably benign Het
Eif4a3 T C 11: 119,293,911 I216V probably benign Het
Emp1 A G 6: 135,380,130 I69V probably damaging Het
Epg5 A G 18: 77,965,021 D788G probably benign Het
Eps15 A G 4: 109,368,974 K324E probably damaging Het
Extl3 A G 14: 65,077,622 F37S probably benign Het
Fam83g A G 11: 61,695,168 D194G probably damaging Het
Gcc2 A G 10: 58,276,663 D1005G probably damaging Het
Gm10226 T A 17: 21,692,009 H50Q possibly damaging Het
Gm1110 A T 9: 26,889,638 V420E probably damaging Het
Gm16503 A G 4: 147,541,210 R54G unknown Het
Gm5538 A G 3: 59,745,503 K121R possibly damaging Het
Grasp T C 15: 101,226,969 probably benign Het
Grin3b T C 10: 79,974,598 M646T probably damaging Het
Grm8 T C 6: 27,363,584 D644G probably benign Het
Gtf2i C A 5: 134,246,848 V660F probably damaging Het
Heatr4 G T 12: 83,955,817 Q808K probably benign Het
Htr2b C T 1: 86,099,801 V328M probably damaging Het
Jph1 T C 1: 17,092,055 T128A probably damaging Het
Kcnt1 T C 2: 25,900,469 V481A probably damaging Het
Khk A G 5: 30,930,618 Y212C probably damaging Het
Lgi2 T A 5: 52,546,632 Q219L probably benign Het
Lipf T A 19: 33,965,675 Y128N probably benign Het
Lipg A G 18: 74,960,937 V13A probably benign Het
Lrrc8e T C 8: 4,235,202 S476P probably benign Het
Map2k7 T G 8: 4,245,795 V425G probably benign Het
Mycbp2 A T 14: 103,184,883 S2451R probably damaging Het
Mylk3 A G 8: 85,327,192 S629P probably damaging Het
Nrp2 A T 1: 62,762,747 I450F probably damaging Het
Olfr1261 T C 2: 89,993,804 V137A probably benign Het
Olfr150 A G 9: 39,737,622 D269G probably benign Het
Osbpl11 T C 16: 33,185,843 S14P probably benign Het
Osbpl11 T A 16: 33,210,095 V231D possibly damaging Het
Parg T A 14: 32,208,227 probably benign Het
Pax9 G T 12: 56,697,138 R190L possibly damaging Het
Prss12 G A 3: 123,506,495 V752I probably benign Het
Pstpip2 A G 18: 77,835,192 N34S probably damaging Het
Rarg T C 15: 102,252,445 D53G probably benign Het
Rbak T C 5: 143,176,116 K53R probably damaging Het
Scgn A T 13: 23,978,825 S107R probably damaging Het
Sema3c A G 5: 17,727,401 Q634R probably benign Het
Serpinh1 A G 7: 99,349,081 L114P probably damaging Het
Slc35f4 T C 14: 49,303,923 probably benign Het
Sned1 A T 1: 93,274,162 I617F probably null Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Spen A G 4: 141,472,598 L2883P probably damaging Het
Stmn3 A T 2: 181,307,280 M140K possibly damaging Het
Syn3 A G 10: 86,354,344 probably null Het
Tor4a A G 2: 25,195,402 V163A possibly damaging Het
Ttc12 A G 9: 49,460,398 Y189H probably damaging Het
Ubxn7 T G 16: 32,381,759 probably benign Het
Unc5b G A 10: 60,778,248 T274I probably damaging Het
Upk1b C A 16: 38,776,186 probably null Het
Usp18 A G 6: 121,268,554 I296M probably benign Het
Usp42 A G 5: 143,715,056 Y1071H probably damaging Het
Vil1 A G 1: 74,418,525 T106A probably benign Het
Vmn1r42 T A 6: 89,844,967 I207F probably benign Het
Vmn1r63 A G 7: 5,803,226 F136L probably damaging Het
Vopp1 C T 6: 57,754,587 V140I probably benign Het
Wdhd1 T C 14: 47,258,577 D610G possibly damaging Het
Wdr48 T A 9: 119,912,417 D142E probably benign Het
Whrn A G 4: 63,494,732 Y10H probably damaging Het
Zmat3 A G 3: 32,343,348 V216A probably benign Het
Zmym2 C T 14: 56,959,842 R1356W probably damaging Het
Zyg11b A T 4: 108,272,283 L44Q probably damaging Het
Other mutations in Hif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Hif3a APN 7 17051916 splice site probably null
IGL02496:Hif3a APN 7 17039678 splice site probably benign
IGL02572:Hif3a APN 7 17050588 missense probably null
IGL02638:Hif3a APN 7 17044368 unclassified probably benign
IGL02704:Hif3a APN 7 17050761 unclassified probably benign
IGL03000:Hif3a APN 7 17048639 missense probably benign 0.08
IGL03342:Hif3a APN 7 17041122 missense possibly damaging 0.92
R0265:Hif3a UTSW 7 17035868 makesense probably null
R0326:Hif3a UTSW 7 17044400 missense probably benign 0.01
R0396:Hif3a UTSW 7 17052021 splice site probably benign
R1494:Hif3a UTSW 7 17054722 missense probably damaging 1.00
R1529:Hif3a UTSW 7 17042639 missense probably benign 0.02
R1548:Hif3a UTSW 7 17044403 missense probably benign 0.00
R1686:Hif3a UTSW 7 17044864 missense possibly damaging 0.46
R2026:Hif3a UTSW 7 17044397 missense possibly damaging 0.81
R2032:Hif3a UTSW 7 17051179 missense probably damaging 1.00
R2354:Hif3a UTSW 7 17041105 missense probably damaging 1.00
R3693:Hif3a UTSW 7 17041074 missense probably damaging 1.00
R3780:Hif3a UTSW 7 17054713 missense probably damaging 1.00
R3921:Hif3a UTSW 7 17037172 missense possibly damaging 0.80
R4003:Hif3a UTSW 7 17044919 missense probably damaging 0.99
R4714:Hif3a UTSW 7 17056271 missense probably damaging 1.00
R4953:Hif3a UTSW 7 17050565 missense probably damaging 0.98
R5632:Hif3a UTSW 7 17050655 missense possibly damaging 0.94
R5778:Hif3a UTSW 7 17051984 missense probably damaging 1.00
R5877:Hif3a UTSW 7 17051146 missense probably damaging 1.00
R5995:Hif3a UTSW 7 17053769 missense probably benign 0.10
R6001:Hif3a UTSW 7 17050561 missense probably damaging 1.00
R6599:Hif3a UTSW 7 17042605 missense possibly damaging 0.68
R7218:Hif3a UTSW 7 17050588 missense probably damaging 1.00
R7478:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7479:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7480:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7482:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7654:Hif3a UTSW 7 17049096 missense probably damaging 0.97
R7696:Hif3a UTSW 7 17054787 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGTACTAGCTACGTATTTGC -3'
(R):5'- TCACAGTTCCTATGAGTGAAAGG -3'

Sequencing Primer
(F):5'- AGAGGATCAAGGTCCTGTCTC -3'
(R):5'- CAGTTCCTATGAGTGAAAGGATGCTC -3'
Posted On2014-07-14