Incidental Mutation 'R1916:Dock6'
ID214870
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 039934-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R1916 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21813091 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 301 (M301K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000217336]
Predicted Effect probably damaging
Transcript: ENSMUST00000034728
AA Change: M1537K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: M1537K

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184374
Predicted Effect probably damaging
Transcript: ENSMUST00000215729
AA Change: M301K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217336
AA Change: M1568K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.8893 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,768,475 T588A probably damaging Het
Abca13 G T 11: 9,534,456 W4342L probably damaging Het
Abcg8 A T 17: 84,688,530 probably null Het
Acaa1b A G 9: 119,156,662 L65P probably damaging Het
Adam6a G T 12: 113,545,936 R643L probably benign Het
Agbl2 A T 2: 90,815,441 R839S possibly damaging Het
Ambra1 A T 2: 91,911,461 N967I probably damaging Het
Ankrd17 T A 5: 90,260,141 N1406Y probably damaging Het
Bbx G T 16: 50,266,245 S96Y probably damaging Het
Casc1 A C 6: 145,176,200 V631G probably benign Het
Cdh12 T A 15: 21,520,250 probably null Het
Cdh9 A C 15: 16,823,275 R114S probably benign Het
Cenpo T G 12: 4,216,683 I142L probably benign Het
Cfap69 T C 5: 5,663,970 K21E probably damaging Het
Chmp4c A T 3: 10,389,936 D221V probably benign Het
Cstf3 T A 2: 104,655,756 V447D possibly damaging Het
Cwc22 A T 2: 77,905,475 C566S probably benign Het
Dgkh A G 14: 78,595,223 M798T probably damaging Het
Dnaic2 T C 11: 114,732,923 V4A possibly damaging Het
Dnmbp T G 19: 43,901,568 I587L possibly damaging Het
Dock8 T C 19: 25,061,157 M69T probably benign Het
Ears2 T C 7: 122,044,578 S386G probably benign Het
Ecsit T C 9: 22,072,521 I371V probably benign Het
Eif4a3 T C 11: 119,293,911 I216V probably benign Het
Emp1 A G 6: 135,380,130 I69V probably damaging Het
Epg5 A G 18: 77,965,021 D788G probably benign Het
Eps15 A G 4: 109,368,974 K324E probably damaging Het
Extl3 A G 14: 65,077,622 F37S probably benign Het
Fam83g A G 11: 61,695,168 D194G probably damaging Het
Gcc2 A G 10: 58,276,663 D1005G probably damaging Het
Gm10226 T A 17: 21,692,009 H50Q possibly damaging Het
Gm1110 A T 9: 26,889,638 V420E probably damaging Het
Gm16503 A G 4: 147,541,210 R54G unknown Het
Gm5538 A G 3: 59,745,503 K121R possibly damaging Het
Grasp T C 15: 101,226,969 probably benign Het
Grin3b T C 10: 79,974,598 M646T probably damaging Het
Grm8 T C 6: 27,363,584 D644G probably benign Het
Gtf2i C A 5: 134,246,848 V660F probably damaging Het
Heatr4 G T 12: 83,955,817 Q808K probably benign Het
Hif3a T C 7: 17,039,656 S573G possibly damaging Het
Htr2b C T 1: 86,099,801 V328M probably damaging Het
Jph1 T C 1: 17,092,055 T128A probably damaging Het
Kcnt1 T C 2: 25,900,469 V481A probably damaging Het
Khk A G 5: 30,930,618 Y212C probably damaging Het
Lgi2 T A 5: 52,546,632 Q219L probably benign Het
Lipf T A 19: 33,965,675 Y128N probably benign Het
Lipg A G 18: 74,960,937 V13A probably benign Het
Lrrc8e T C 8: 4,235,202 S476P probably benign Het
Map2k7 T G 8: 4,245,795 V425G probably benign Het
Mycbp2 A T 14: 103,184,883 S2451R probably damaging Het
Mylk3 A G 8: 85,327,192 S629P probably damaging Het
Nrp2 A T 1: 62,762,747 I450F probably damaging Het
Olfr1261 T C 2: 89,993,804 V137A probably benign Het
Olfr150 A G 9: 39,737,622 D269G probably benign Het
Osbpl11 T C 16: 33,185,843 S14P probably benign Het
Osbpl11 T A 16: 33,210,095 V231D possibly damaging Het
Parg T A 14: 32,208,227 probably benign Het
Pax9 G T 12: 56,697,138 R190L possibly damaging Het
Prss12 G A 3: 123,506,495 V752I probably benign Het
Pstpip2 A G 18: 77,835,192 N34S probably damaging Het
Rarg T C 15: 102,252,445 D53G probably benign Het
Rbak T C 5: 143,176,116 K53R probably damaging Het
Scgn A T 13: 23,978,825 S107R probably damaging Het
Sema3c A G 5: 17,727,401 Q634R probably benign Het
Serpinh1 A G 7: 99,349,081 L114P probably damaging Het
Slc35f4 T C 14: 49,303,923 probably benign Het
Sned1 A T 1: 93,274,162 I617F probably null Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Spen A G 4: 141,472,598 L2883P probably damaging Het
Stmn3 A T 2: 181,307,280 M140K possibly damaging Het
Syn3 A G 10: 86,354,344 probably null Het
Tor4a A G 2: 25,195,402 V163A possibly damaging Het
Ttc12 A G 9: 49,460,398 Y189H probably damaging Het
Ubxn7 T G 16: 32,381,759 probably benign Het
Unc5b G A 10: 60,778,248 T274I probably damaging Het
Upk1b C A 16: 38,776,186 probably null Het
Usp18 A G 6: 121,268,554 I296M probably benign Het
Usp42 A G 5: 143,715,056 Y1071H probably damaging Het
Vil1 A G 1: 74,418,525 T106A probably benign Het
Vmn1r42 T A 6: 89,844,967 I207F probably benign Het
Vmn1r63 A G 7: 5,803,226 F136L probably damaging Het
Vopp1 C T 6: 57,754,587 V140I probably benign Het
Wdhd1 T C 14: 47,258,577 D610G possibly damaging Het
Wdr48 T A 9: 119,912,417 D142E probably benign Het
Whrn A G 4: 63,494,732 Y10H probably damaging Het
Zmat3 A G 3: 32,343,348 V216A probably benign Het
Zmym2 C T 14: 56,959,842 R1356W probably damaging Het
Zyg11b A T 4: 108,272,283 L44Q probably damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21801207 missense unknown
R7863:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R7930:Dock6 UTSW 9 21801207 missense unknown
R7946:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R8012:Dock6 UTSW 9 21846511 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CATGCATTGTCCACAGCAGG -3'
(R):5'- AGAGCATTGCTACAGGACCC -3'

Sequencing Primer
(F):5'- TTGTCCACAGCAGGGAGGAC -3'
(R):5'- GCAAGTTTCACCCAGTGTCATAGG -3'
Posted On2014-07-14