Incidental Mutation 'R1916:Ecsit'
ID 214871
Institutional Source Beutler Lab
Gene Symbol Ecsit
Ensembl Gene ENSMUSG00000066839
Gene Name ECSIT signalling integrator
Synonyms Sitpec
MMRRC Submission 039934-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1916 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 21983542-21996734 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21983817 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 371 (I371V)
Ref Sequence ENSEMBL: ENSMUSP00000136247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043922] [ENSMUST00000098937] [ENSMUST00000177967] [ENSMUST00000179422] [ENSMUST00000179605] [ENSMUST00000180180]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000043922
SMART Domains Protein: ENSMUSP00000045895
Gene: ENSMUSG00000038895

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
ZnF_C2H2 467 492 4.11e-2 SMART
ZnF_C2H2 498 522 4.47e-3 SMART
ZnF_C2H2 528 550 4.87e-4 SMART
ZnF_C2H2 556 578 2.99e-4 SMART
ZnF_C2H2 586 609 1.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098937
AA Change: I371V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096537
Gene: ENSMUSG00000066839
AA Change: I371V

DomainStartEndE-ValueType
Pfam:ECSIT 39 267 5e-106 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177967
SMART Domains Protein: ENSMUSP00000135936
Gene: ENSMUSG00000066839

DomainStartEndE-ValueType
Pfam:ECSIT 1 197 4.4e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179422
AA Change: I371V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137424
Gene: ENSMUSG00000066839
AA Change: I371V

DomainStartEndE-ValueType
Pfam:ECSIT 39 267 5e-106 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179605
SMART Domains Protein: ENSMUSP00000137064
Gene: ENSMUSG00000038895

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 451 464 N/A INTRINSIC
ZnF_C2H2 475 500 4.11e-2 SMART
ZnF_C2H2 506 530 4.47e-3 SMART
ZnF_C2H2 536 558 4.87e-4 SMART
ZnF_C2H2 564 586 2.99e-4 SMART
ZnF_C2H2 594 617 1.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180180
AA Change: I371V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136247
Gene: ENSMUSG00000066839
AA Change: I371V

DomainStartEndE-ValueType
Pfam:ECSIT 44 266 6.2e-108 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180419
Predicted Effect probably benign
Transcript: ENSMUST00000213738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216916
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency 99% (97/98)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die around the stage of gastrulation showing abnormal epiblast patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm2 A G 3: 59,652,924 (GRCm39) K121R possibly damaging Het
Abca13 G T 11: 9,484,456 (GRCm39) W4342L probably damaging Het
Abcg8 A T 17: 84,995,958 (GRCm39) probably null Het
Acaa1b A G 9: 118,985,730 (GRCm39) L65P probably damaging Het
Adam6a G T 12: 113,509,556 (GRCm39) R643L probably benign Het
Agbl2 A T 2: 90,645,785 (GRCm39) R839S possibly damaging Het
Ambra1 A T 2: 91,741,806 (GRCm39) N967I probably damaging Het
Ankrd17 T A 5: 90,408,000 (GRCm39) N1406Y probably damaging Het
Armh4 T C 14: 50,005,932 (GRCm39) T588A probably damaging Het
Bbx G T 16: 50,086,608 (GRCm39) S96Y probably damaging Het
Cdh12 T A 15: 21,520,336 (GRCm39) probably null Het
Cdh9 A C 15: 16,823,361 (GRCm39) R114S probably benign Het
Cenpo T G 12: 4,266,683 (GRCm39) I142L probably benign Het
Cfap69 T C 5: 5,713,970 (GRCm39) K21E probably damaging Het
Chmp4c A T 3: 10,454,996 (GRCm39) D221V probably benign Het
Cstf3 T A 2: 104,486,101 (GRCm39) V447D possibly damaging Het
Cwc22 A T 2: 77,735,819 (GRCm39) C566S probably benign Het
Dgkh A G 14: 78,832,663 (GRCm39) M798T probably damaging Het
Dnai2 T C 11: 114,623,749 (GRCm39) V4A possibly damaging Het
Dnai7 A C 6: 145,121,926 (GRCm39) V631G probably benign Het
Dnmbp T G 19: 43,890,007 (GRCm39) I587L possibly damaging Het
Dock6 A T 9: 21,724,387 (GRCm39) M301K probably damaging Het
Dock8 T C 19: 25,038,521 (GRCm39) M69T probably benign Het
Ears2 T C 7: 121,643,801 (GRCm39) S386G probably benign Het
Eif4a3 T C 11: 119,184,737 (GRCm39) I216V probably benign Het
Emp1 A G 6: 135,357,128 (GRCm39) I69V probably damaging Het
Epg5 A G 18: 78,008,236 (GRCm39) D788G probably benign Het
Eps15 A G 4: 109,226,171 (GRCm39) K324E probably damaging Het
Extl3 A G 14: 65,315,071 (GRCm39) F37S probably benign Het
Fam83g A G 11: 61,585,994 (GRCm39) D194G probably damaging Het
Gcc2 A G 10: 58,112,485 (GRCm39) D1005G probably damaging Het
Gm10226 T A 17: 21,910,916 (GRCm39) H50Q possibly damaging Het
Gm1110 A T 9: 26,800,934 (GRCm39) V420E probably damaging Het
Gm16503 A G 4: 147,625,667 (GRCm39) R54G unknown Het
Grin3b T C 10: 79,810,432 (GRCm39) M646T probably damaging Het
Grm8 T C 6: 27,363,583 (GRCm39) D644G probably benign Het
Gtf2i C A 5: 134,275,702 (GRCm39) V660F probably damaging Het
Heatr4 G T 12: 84,002,591 (GRCm39) Q808K probably benign Het
Hif3a T C 7: 16,773,581 (GRCm39) S573G possibly damaging Het
Htr2b C T 1: 86,027,523 (GRCm39) V328M probably damaging Het
Jph1 T C 1: 17,162,279 (GRCm39) T128A probably damaging Het
Kcnt1 T C 2: 25,790,481 (GRCm39) V481A probably damaging Het
Khk A G 5: 31,087,962 (GRCm39) Y212C probably damaging Het
Lgi2 T A 5: 52,703,974 (GRCm39) Q219L probably benign Het
Lipf T A 19: 33,943,075 (GRCm39) Y128N probably benign Het
Lipg A G 18: 75,094,008 (GRCm39) V13A probably benign Het
Lrrc8e T C 8: 4,285,202 (GRCm39) S476P probably benign Het
Map2k7 T G 8: 4,295,795 (GRCm39) V425G probably benign Het
Mycbp2 A T 14: 103,422,319 (GRCm39) S2451R probably damaging Het
Mylk3 A G 8: 86,053,821 (GRCm39) S629P probably damaging Het
Nrp2 A T 1: 62,801,906 (GRCm39) I450F probably damaging Het
Or4c126 T C 2: 89,824,148 (GRCm39) V137A probably benign Het
Or8g50 A G 9: 39,648,918 (GRCm39) D269G probably benign Het
Osbpl11 T C 16: 33,006,213 (GRCm39) S14P probably benign Het
Osbpl11 T A 16: 33,030,465 (GRCm39) V231D possibly damaging Het
Parg T A 14: 31,930,184 (GRCm39) probably benign Het
Pax9 G T 12: 56,743,923 (GRCm39) R190L possibly damaging Het
Prss12 G A 3: 123,300,144 (GRCm39) V752I probably benign Het
Pstpip2 A G 18: 77,922,892 (GRCm39) N34S probably damaging Het
Rarg T C 15: 102,160,880 (GRCm39) D53G probably benign Het
Rbak T C 5: 143,161,871 (GRCm39) K53R probably damaging Het
Scgn A T 13: 24,162,808 (GRCm39) S107R probably damaging Het
Sema3c A G 5: 17,932,399 (GRCm39) Q634R probably benign Het
Serpinh1 A G 7: 98,998,288 (GRCm39) L114P probably damaging Het
Slc35f4 T C 14: 49,541,380 (GRCm39) probably benign Het
Sned1 A T 1: 93,201,884 (GRCm39) I617F probably null Het
Spata31 C T 13: 65,070,359 (GRCm39) R836* probably null Het
Spen A G 4: 141,199,909 (GRCm39) L2883P probably damaging Het
Stmn3 A T 2: 180,949,073 (GRCm39) M140K possibly damaging Het
Syn3 A G 10: 86,190,208 (GRCm39) probably null Het
Tamalin T C 15: 101,124,850 (GRCm39) probably benign Het
Tor4a A G 2: 25,085,414 (GRCm39) V163A possibly damaging Het
Ttc12 A G 9: 49,371,698 (GRCm39) Y189H probably damaging Het
Ubxn7 T G 16: 32,200,577 (GRCm39) probably benign Het
Unc5b G A 10: 60,614,027 (GRCm39) T274I probably damaging Het
Upk1b C A 16: 38,596,548 (GRCm39) probably null Het
Usp18 A G 6: 121,245,513 (GRCm39) I296M probably benign Het
Usp42 A G 5: 143,700,811 (GRCm39) Y1071H probably damaging Het
Vil1 A G 1: 74,457,684 (GRCm39) T106A probably benign Het
Vmn1r42 T A 6: 89,821,949 (GRCm39) I207F probably benign Het
Vmn1r63 A G 7: 5,806,225 (GRCm39) F136L probably damaging Het
Vopp1 C T 6: 57,731,572 (GRCm39) V140I probably benign Het
Wdhd1 T C 14: 47,496,034 (GRCm39) D610G possibly damaging Het
Wdr48 T A 9: 119,741,483 (GRCm39) D142E probably benign Het
Whrn A G 4: 63,412,969 (GRCm39) Y10H probably damaging Het
Zmat3 A G 3: 32,397,497 (GRCm39) V216A probably benign Het
Zmym2 C T 14: 57,197,299 (GRCm39) R1356W probably damaging Het
Zyg11b A T 4: 108,129,480 (GRCm39) L44Q probably damaging Het
Other mutations in Ecsit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Ecsit APN 9 21,984,310 (GRCm39) missense probably benign 0.00
IGL02114:Ecsit APN 9 21,989,440 (GRCm39) splice site probably benign
IGL02457:Ecsit APN 9 21,989,500 (GRCm39) missense probably damaging 0.98
IGL03365:Ecsit APN 9 21,987,822 (GRCm39) missense probably damaging 0.99
charade UTSW 9 21,984,780 (GRCm39) missense probably damaging 1.00
hoax UTSW 9 21,987,796 (GRCm39) missense probably benign 0.00
PIT4458001:Ecsit UTSW 9 21,987,580 (GRCm39) missense probably damaging 1.00
R0051:Ecsit UTSW 9 21,987,584 (GRCm39) missense probably benign 0.01
R0051:Ecsit UTSW 9 21,987,584 (GRCm39) missense probably benign 0.01
R0684:Ecsit UTSW 9 21,987,796 (GRCm39) missense probably benign 0.00
R1703:Ecsit UTSW 9 21,986,107 (GRCm39) missense probably damaging 1.00
R1903:Ecsit UTSW 9 21,987,815 (GRCm39) missense possibly damaging 0.74
R2280:Ecsit UTSW 9 21,987,836 (GRCm39) missense possibly damaging 0.73
R2281:Ecsit UTSW 9 21,987,836 (GRCm39) missense possibly damaging 0.73
R5983:Ecsit UTSW 9 21,989,443 (GRCm39) critical splice donor site probably null
R6157:Ecsit UTSW 9 21,985,987 (GRCm39) missense probably damaging 1.00
R6474:Ecsit UTSW 9 21,985,981 (GRCm39) missense possibly damaging 0.91
R7977:Ecsit UTSW 9 21,984,780 (GRCm39) missense probably damaging 1.00
R7987:Ecsit UTSW 9 21,984,780 (GRCm39) missense probably damaging 1.00
R8050:Ecsit UTSW 9 21,987,592 (GRCm39) missense probably benign 0.03
X0024:Ecsit UTSW 9 21,986,111 (GRCm39) critical splice acceptor site probably null
X0025:Ecsit UTSW 9 21,983,700 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCCTGAATGGTCTCATC -3'
(R):5'- CCTCCAAGTTAGGGCTCAAAC -3'

Sequencing Primer
(F):5'- GAATGGTCTCATCATCTTCCTCAGG -3'
(R):5'- CTCCAAGTTAGGGCTCAAACTTAGTC -3'
Posted On 2014-07-14