Incidental Mutation 'R1927:Slc41a1'
ID214920
Institutional Source Beutler Lab
Gene Symbol Slc41a1
Ensembl Gene ENSMUSG00000013275
Gene Namesolute carrier family 41, member 1
Synonyms
MMRRC Submission 039945-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1927 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location131827493-131848865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131841200 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 256 (I256T)
Ref Sequence ENSEMBL: ENSMUSP00000083747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086559]
Predicted Effect probably damaging
Transcript: ENSMUST00000086559
AA Change: I256T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083747
Gene: ENSMUSG00000013275
AA Change: I256T

DomainStartEndE-ValueType
transmembrane domain 97 119 N/A INTRINSIC
Pfam:MgtE 138 272 1.9e-25 PFAM
transmembrane domain 283 305 N/A INTRINSIC
transmembrane domain 314 336 N/A INTRINSIC
Pfam:MgtE 352 496 1.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146360
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Dyx1c1 A T 9: 72,960,627 I57L probably damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Eml1 C T 12: 108,538,217 R812* probably null Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Kdm4c C T 4: 74,345,483 T668I probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr1463 T C 19: 13,235,029 Y260H probably damaging Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Rtp1 T A 16: 23,431,209 I108N probably damaging Het
Sema6b A T 17: 56,132,797 F15I probably benign Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc22a29 A G 19: 8,207,066 I257T probably benign Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sorcs1 G T 19: 50,222,195 P744Q probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stat3 T C 11: 100,894,829 N465S probably damaging Het
Stmn2 T A 3: 8,545,576 M40K probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Znrf3 A G 11: 5,281,062 V817A probably benign Het
Other mutations in Slc41a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Slc41a1 APN 1 131839176 missense probably damaging 1.00
IGL01368:Slc41a1 APN 1 131839124 missense probably damaging 0.99
R0255:Slc41a1 UTSW 1 131843912 splice site probably benign
R0737:Slc41a1 UTSW 1 131840952 missense probably damaging 1.00
R1367:Slc41a1 UTSW 1 131844008 missense probably benign
R1474:Slc41a1 UTSW 1 131846581 missense probably damaging 0.98
R4518:Slc41a1 UTSW 1 131839125 missense probably damaging 0.99
R4790:Slc41a1 UTSW 1 131830952 missense probably damaging 1.00
R4851:Slc41a1 UTSW 1 131830770 missense probably benign 0.02
R5180:Slc41a1 UTSW 1 131844377 missense probably damaging 0.99
R5633:Slc41a1 UTSW 1 131846587 missense possibly damaging 0.68
R6060:Slc41a1 UTSW 1 131840234 missense probably benign 0.04
R6526:Slc41a1 UTSW 1 131841149 missense probably damaging 1.00
R6787:Slc41a1 UTSW 1 131842749 splice site probably null
R7038:Slc41a1 UTSW 1 131842057 missense possibly damaging 0.60
R7258:Slc41a1 UTSW 1 131842042 missense probably benign 0.27
R7382:Slc41a1 UTSW 1 131846632 missense probably damaging 1.00
R7405:Slc41a1 UTSW 1 131839146 missense probably damaging 1.00
R7432:Slc41a1 UTSW 1 131830956 missense probably damaging 1.00
R7574:Slc41a1 UTSW 1 131839151 missense probably damaging 1.00
R7873:Slc41a1 UTSW 1 131830823 missense possibly damaging 0.62
R7942:Slc41a1 UTSW 1 131840897 missense probably damaging 0.99
R7956:Slc41a1 UTSW 1 131844028 missense possibly damaging 0.53
Z1177:Slc41a1 UTSW 1 131843986 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGGCCACTTTAGCATCCC -3'
(R):5'- CGCCCAGAAGTTGTGACAAAC -3'

Sequencing Primer
(F):5'- CCTCCTTGGTCCTGGGTAAG -3'
(R):5'- CCCAGAAGTTGTGACAAACTGTTCG -3'
Posted On2014-07-14