Mutagenetix > Incidental Mutations

Incidental Mutation 'R1927:Galnt5'

214925

Institutional Source

Beutler Lab

Gene Symbol

Galnt5

Ensembl Gene

ENSMUSG00000026828

Gene Name

polypeptide N-acetylgalactosaminyltransferase 5

Synonyms

ppGaNTase-T5

MMRRC Submission

039945-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1927 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57997884-58045860 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57998603 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 72 (R72G)

Ref Sequence

ENSEMBL: ENSMUSP00000131362 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]

Predicted Effect

probably benign
Transcript: ENSMUST00000112616
AA Change: R72G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: R72G

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	319	330	N/A	INTRINSIC
Pfam:Glycos_transf_2	489	672	1.3e-33	PFAM
Pfam:Glyco_transf_7C	653	718	1.9e-8	PFAM
RICIN	801	925	1.36e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144671

Predicted Effect

probably benign
Transcript: ENSMUST00000166729
AA Change: R72G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: R72G

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	319	330	N/A	INTRINSIC
Pfam:Glycos_transf_2	489	672	2.1e-30	PFAM
Pfam:Glyco_transf_7C	652	718	7e-8	PFAM
RICIN	801	925	1.36e-19	SMART

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,636,379	S31P	probably damaging	Het
Abca12	G	T	1: 71,244,840	H2524Q	probably damaging	Het
Acsl5	T	C	19: 55,278,154	V135A	probably benign	Het
Actl11	T	G	9: 107,929,537	L353R	possibly damaging	Het
Adcy6	G	T	15: 98,598,498		probably null	Het
B230104I21Rik	A	G	4: 154,341,237	I697T	probably damaging	Het
BC061237	G	A	14: 44,501,243	R33K	possibly damaging	Het
Brf1	C	A	12: 113,000,344	V5F	possibly damaging	Het
Chmp2a	C	T	7: 13,033,936	A21T	possibly damaging	Het
Cwh43	A	G	5: 73,453,074	N607S	probably benign	Het
Ddhd2	G	A	8: 25,741,661	L445F	possibly damaging	Het
Dicer1	C	A	12: 104,702,884	D1180Y	possibly damaging	Het
Dock5	A	T	14: 67,846,062	S133T	possibly damaging	Het
Dyx1c1	A	T	9: 72,960,627	I57L	probably damaging	Het
Efs	A	T	14: 54,917,163	C540S	possibly damaging	Het
Ehd4	C	T	2: 120,091,492	G428S	probably benign	Het
Eml1	C	T	12: 108,538,217	R812*	probably null	Het
Enpp1	C	T	10: 24,654,888	D557N	possibly damaging	Het
Fn3krp	A	G	11: 121,424,977	T65A	probably damaging	Het
Gfod1	C	T	13: 43,200,860	R213H	possibly damaging	Het
Gm10518	A	G	1: 179,803,645		probably benign	Het
Gm5431	A	G	11: 48,889,255	F558S	probably damaging	Het
Got1	C	T	19: 43,515,680		probably null	Het
Gucy2g	C	T	19: 55,237,759	V242I	probably benign	Het
Hdgfl2	T	A	17: 56,099,874	V606E	possibly damaging	Het
Hoxa3	T	C	6: 52,169,999		probably benign	Het
Iqub	T	A	6: 24,491,671	I339L	probably benign	Het
Kdm4c	C	T	4: 74,345,483	T668I	probably benign	Het
Klhl32	T	C	4: 24,617,474	I592V	probably benign	Het
Mfsd12	G	T	10: 81,362,087	M296I	probably benign	Het
Mfsd4b4	C	T	10: 39,892,441	A219T	probably damaging	Het
Mrpl52	T	C	14: 54,426,957	S9P	possibly damaging	Het
Nbr1	A	G	11: 101,567,214	Y273C	possibly damaging	Het
Ncf4	G	T	15: 78,260,646	G217V	probably damaging	Het
Neo1	T	C	9: 58,990,385	E96G	probably benign	Het
Nid2	T	A	14: 19,768,276	N279K	probably damaging	Het
Nr5a2	A	G	1: 136,944,994	Y56H	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nynrin	A	G	14: 55,863,592	T280A	probably benign	Het
Olfr1364	A	G	13: 21,574,256	F67L	probably benign	Het
Olfr1367	T	A	13: 21,346,946	I6N	probably benign	Het
Olfr1463	T	C	19: 13,235,029	Y260H	probably damaging	Het
Olfr545	A	G	7: 102,494,059	S239P	possibly damaging	Het
Olfr97	A	G	17: 37,231,543	Y276H	probably damaging	Het
Otog	G	A	7: 46,246,283	C107Y	probably damaging	Het
Ptprn	A	G	1: 75,254,122	V565A	probably benign	Het
Rbm6	T	G	9: 107,852,903	D182A	probably damaging	Het
Rhbg	A	G	3: 88,244,552	F400L	probably benign	Het
Rpl22l1	T	A	3: 28,806,589	N33K	possibly damaging	Het
Rtp1	T	A	16: 23,431,209	I108N	probably damaging	Het
Sema6b	A	T	17: 56,132,797	F15I	probably benign	Het
Sirpa	C	T	2: 129,616,376	T304I	possibly damaging	Het
Slc22a29	A	G	19: 8,207,066	I257T	probably benign	Het
Slc41a1	T	C	1: 131,841,200	I256T	probably damaging	Het
Smg6	A	G	11: 75,142,848	K1208R	probably damaging	Het
Sorcs1	G	T	19: 50,222,195	P744Q	probably damaging	Het
Sptbn5	T	C	2: 120,070,462	T213A	probably benign	Het
St18	A	G	1: 6,802,712	T224A	probably benign	Het
Stat3	T	C	11: 100,894,829	N465S	probably damaging	Het
Stmn2	T	A	3: 8,545,576	M40K	probably benign	Het
Tespa1	A	G	10: 130,348,239	D63G	probably benign	Het
Thrb	T	A	14: 18,008,674	C133S	probably damaging	Het
Tmem25	C	T	9: 44,796,483	V172M	possibly damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trhde	T	A	10: 114,800,849	Y151F	probably damaging	Het
Trp53bp2	A	G	1: 182,452,664	T912A	probably damaging	Het
Unc79	C	A	12: 103,169,692	A2269E	probably damaging	Het
Zfp507	C	T	7: 35,793,725	R631Q	probably damaging	Het
Zfp758	T	G	17: 22,375,842	S436R	probably damaging	Het
Zfp791	G	T	8: 85,110,683	T184K	probably benign	Het
Znrf3	A	G	11: 5,281,062	V817A	probably benign	Het

Other mutations in Galnt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Galnt5	APN	2	57998973	missense	probably benign
IGL00515:Galnt5	APN	2	57999068	missense	probably benign	0.02
IGL00950:Galnt5	APN	2	57999132	missense	probably benign	0.00
IGL00973:Galnt5	APN	2	57998939	missense	probably benign	0.02
IGL01152:Galnt5	APN	2	58025393	missense	probably benign	0.17
IGL01305:Galnt5	APN	2	58025342	nonsense	probably null
IGL01661:Galnt5	APN	2	57999482	missense	probably benign	0.03
IGL01719:Galnt5	APN	2	57998543	missense	probably damaging	1.00
IGL02165:Galnt5	APN	2	57998865	missense	probably benign
IGL02795:Galnt5	APN	2	58027871	missense	probably damaging	1.00
IGL02943:Galnt5	APN	2	57999768	missense	probably damaging	1.00
IGL03218:Galnt5	APN	2	57999389	missense	possibly damaging	0.59
ANU22:Galnt5	UTSW	2	58025342	nonsense	probably null
R0082:Galnt5	UTSW	2	57999035	missense	possibly damaging	0.92
R0113:Galnt5	UTSW	2	57998877	missense	probably benign
R0445:Galnt5	UTSW	2	57998950	missense	probably benign
R0517:Galnt5	UTSW	2	58035373	splice site	probably benign
R0609:Galnt5	UTSW	2	58024625	missense	possibly damaging	0.90
R0639:Galnt5	UTSW	2	57999395	missense	probably benign	0.07
R0646:Galnt5	UTSW	2	57999085	missense	probably benign	0.00
R0677:Galnt5	UTSW	2	57998980	nonsense	probably null
R1808:Galnt5	UTSW	2	58026125	missense	probably benign	0.24
R1980:Galnt5	UTSW	2	58024723	critical splice donor site	probably null
R2517:Galnt5	UTSW	2	57999413	missense	probably benign	0.00
R4044:Galnt5	UTSW	2	57998460	missense	probably damaging	1.00
R4154:Galnt5	UTSW	2	57998493	missense	probably damaging	1.00
R4411:Galnt5	UTSW	2	57999195	missense	probably benign	0.01
R4703:Galnt5	UTSW	2	57998907	missense	possibly damaging	0.96
R4767:Galnt5	UTSW	2	58028144	missense	possibly damaging	0.91
R5118:Galnt5	UTSW	2	58015003	missense	probably damaging	1.00
R5497:Galnt5	UTSW	2	58025328	missense	probably damaging	0.99
R5506:Galnt5	UTSW	2	57999625	missense	probably benign
R5548:Galnt5	UTSW	2	58014910	missense	probably damaging	0.99
R5758:Galnt5	UTSW	2	57998430	missense	probably benign	0.19
R5937:Galnt5	UTSW	2	58038937	missense	probably benign	0.00
R6237:Galnt5	UTSW	2	58035249	missense	probably damaging	0.96
R6805:Galnt5	UTSW	2	58035299	missense	possibly damaging	0.82
R6959:Galnt5	UTSW	2	57999219	missense	probably benign	0.39
R7070:Galnt5	UTSW	2	57998609	missense	probably benign	0.00
R7179:Galnt5	UTSW	2	57998609	missense	probably benign	0.06
R7347:Galnt5	UTSW	2	58017193	missense	probably benign	0.33
R7419:Galnt5	UTSW	2	58014925	missense	probably damaging	1.00
R7426:Galnt5	UTSW	2	58017139	missense	probably damaging	0.99
R7492:Galnt5	UTSW	2	58026036	splice site	probably null
R7539:Galnt5	UTSW	2	58035230	missense	probably damaging	0.99
R7623:Galnt5	UTSW	2	58017210	missense	probably damaging	0.99
R8135:Galnt5	UTSW	2	58014868	missense	probably damaging	1.00
R8155:Galnt5	UTSW	2	57999415	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCAAGTCAGCCTTTGTACG -3'
(R):5'- TGTGCAAGATGCCACAAAGG -3'

Sequencing Primer
(F):5'- GCCTTTGTACGATGAACAAGATCCG -3'
(R):5'- GGCACAGCCTTTCTCCTTC -3'

Posted On

2014-07-14