Incidental Mutation 'R0127:Sptbn2'
ID21493
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Namespectrin beta, non-erythrocytic 2
SynonymsSpnb3
MMRRC Submission 038412-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0127 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location4711208-4752353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4724744 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 142 (V142L)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991]
Predicted Effect probably damaging
Transcript: ENSMUST00000008991
AA Change: V142L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: V142L

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Meta Mutation Damage Score 0.5396 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,454 T152A probably benign Het
Abca1 T C 4: 53,067,155 I1351V probably benign Het
Acap1 A T 11: 69,887,217 probably benign Het
Als2cl T C 9: 110,891,867 L521P probably damaging Het
Ankrd50 T C 3: 38,456,235 D661G probably benign Het
Atp6v1b2 T A 8: 69,103,460 N262K probably damaging Het
Baz1a T A 12: 54,898,706 D1288V possibly damaging Het
Bbs1 A T 19: 4,895,029 D371E probably benign Het
Bphl A G 13: 34,064,046 probably benign Het
Caskin2 C A 11: 115,800,994 R988S probably damaging Het
Cbr1 C A 16: 93,609,987 T197N probably damaging Het
Ccdc88c T C 12: 100,935,740 E1213G possibly damaging Het
Ccna1 A G 3: 55,049,748 F83L probably damaging Het
Cep290 T A 10: 100,536,925 probably benign Het
Cep89 C A 7: 35,428,262 T543K possibly damaging Het
Cmtm7 T C 9: 114,781,670 M45V probably benign Het
Col16a1 T A 4: 130,052,857 V91E probably damaging Het
Csmd3 T C 15: 47,981,930 N920S probably benign Het
Cyp26b1 A G 6: 84,577,208 probably benign Het
Dao T A 5: 114,019,963 H215Q probably damaging Het
Dido1 T C 2: 180,671,824 D885G probably benign Het
Dlx4 T G 11: 95,141,229 M240L probably benign Het
Dnah5 C T 15: 28,294,925 P1351L probably damaging Het
Dnah6 T A 6: 73,038,734 probably benign Het
Dock5 A T 14: 67,846,042 D139E probably benign Het
Fam234b T C 6: 135,218,823 probably benign Het
Fat2 T C 11: 55,289,286 T1410A probably benign Het
Fsip2 T A 2: 82,984,925 N3667K probably benign Het
Gm14085 T A 2: 122,517,069 probably null Het
Gm5114 T C 7: 39,408,456 I580V probably benign Het
Hapln1 A T 13: 89,607,869 Y264F probably benign Het
Heatr5a A G 12: 51,925,405 V694A probably benign Het
Hps1 A G 19: 42,771,111 probably benign Het
Igsf9b G T 9: 27,334,385 R1216L possibly damaging Het
Il4ra G T 7: 125,569,070 C87F probably damaging Het
Kmt5b A G 19: 3,786,465 M1V probably null Het
Krit1 A G 5: 3,822,178 E401G probably damaging Het
Lamp1 T C 8: 13,174,491 V385A probably damaging Het
Ly6g5b A G 17: 35,114,591 Y82H probably damaging Het
Mapre2 A G 18: 23,804,175 I25V probably benign Het
Mep1a A G 17: 43,497,886 probably benign Het
Mgea5 A T 19: 45,771,888 I277N probably damaging Het
Mkrn1 A G 6: 39,399,275 W466R probably benign Het
Muc2 C A 7: 141,748,954 F11L probably benign Het
Nebl T A 2: 17,392,983 M501L probably benign Het
Olfr1151 A G 2: 87,857,483 I103V probably benign Het
Olfr1179 A G 2: 88,402,355 V193A probably benign Het
Olfr744 A G 14: 50,618,332 I37V probably benign Het
Olfr951 A G 9: 39,393,942 I50M probably benign Het
Pkd1l2 A G 8: 117,050,048 probably benign Het
Pkhd1l1 A G 15: 44,554,605 M2886V probably damaging Het
Pop5 T A 5: 115,240,171 L58H probably damaging Het
Prkch C A 12: 73,721,787 H444N possibly damaging Het
Reln T C 5: 22,004,136 D1148G probably damaging Het
Rffl G A 11: 82,812,632 T120M probably damaging Het
Rmdn2 A T 17: 79,670,569 S320C probably damaging Het
Rrbp1 C T 2: 143,989,944 R101H probably benign Het
Rtf1 G A 2: 119,726,743 R443H probably damaging Het
Serac1 G T 17: 6,048,840 L559I probably damaging Het
Slc12a1 A G 2: 125,219,762 R958G probably damaging Het
Slc15a3 T A 19: 10,855,986 W456R probably damaging Het
Slc35f5 C T 1: 125,576,205 P290L probably damaging Het
Slc35g2 C T 9: 100,553,117 R167Q probably benign Het
Spag4 T C 2: 156,068,042 V302A probably damaging Het
Spire2 A C 8: 123,358,097 probably benign Het
Syt17 T A 7: 118,409,941 D352V probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tctex1d1 T C 4: 103,002,452 probably benign Het
Thsd7a A G 6: 12,554,908 S326P probably benign Het
Tnpo2 T C 8: 85,040,628 S64P probably damaging Het
Tonsl G T 15: 76,633,485 A678D probably benign Het
Trim12c A G 7: 104,340,906 probably null Het
Tsc22d1 A G 14: 76,418,981 T885A possibly damaging Het
Ttn T C 2: 76,742,198 D26117G probably damaging Het
Ttn T A 2: 76,877,011 probably benign Het
Ugt3a1 T C 15: 9,306,256 F164L probably benign Het
Vmn2r89 A G 14: 51,455,703 N170S probably damaging Het
Vrk2 G T 11: 26,534,313 probably benign Het
Wt1 C A 2: 105,133,457 D207E probably damaging Het
Zbtb46 G A 2: 181,411,815 A368V probably benign Het
Zc3h13 A T 14: 75,323,254 D428V unknown Het
Zcchc8 C G 5: 123,707,337 G320A probably damaging Het
Znfx1 T C 2: 167,044,210 E810G possibly damaging Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4724705 missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4725938 missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4745972 nonsense probably null
IGL01373:Sptbn2 APN 19 4745972 nonsense probably null
IGL01420:Sptbn2 APN 19 4734125 missense probably benign
IGL01456:Sptbn2 APN 19 4746749 missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4749693 missense probably benign
IGL03026:Sptbn2 APN 19 4724233 critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4732661 missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4747832 missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4745577 missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0121:Sptbn2 UTSW 19 4745293 missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4746942 critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4745145 missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4737926 missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4745938 missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4726690 missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4739986 missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4748123 nonsense probably null
R0742:Sptbn2 UTSW 19 4718983 missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4732665 missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4718976 missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4744246 missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4750242 critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4750497 missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4745964 nonsense probably null
R1820:Sptbn2 UTSW 19 4726596 missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4732541 missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4732685 missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4745299 missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4738559 missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4734138 missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4718935 missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4748636 missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4745922 missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4738355 missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4732602 missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4739239 missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4732496 missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4742480 missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4748154 missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4729430 missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4738469 missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4729309 missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4729202 intron probably null
R4981:Sptbn2 UTSW 19 4751658 missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4737857 missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4724184 missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4750082 missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4718908 missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4750105 missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4725950 missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4748947 missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4724667 missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4738219 missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4739278 missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4731392 critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4748138 missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4724646 missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4732496 missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4742418 missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4744180 missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4747926 missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4749814 missense probably benign
R6703:Sptbn2 UTSW 19 4749815 missense probably benign
R6753:Sptbn2 UTSW 19 4747785 missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4744145 missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4749460 missense probably null
R7219:Sptbn2 UTSW 19 4724173 missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4737443 missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4751574 missense probably benign
R7469:Sptbn2 UTSW 19 4745118 missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4748082 missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4726168 missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4744207 missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4724125 missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4734143 missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4744262 missense possibly damaging 0.93
R7954:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7960:Sptbn2 UTSW 19 4744262 missense possibly damaging 0.93
R8137:Sptbn2 UTSW 19 4737403 missense possibly damaging 0.81
V7580:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4738205 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4745191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGCAGGTTGCTGAAAGACATCGT -3'
(R):5'- TGCCTCAAAGGCAAACTGACATAGAA -3'

Sequencing Primer
(F):5'- AAGACATCGTGGTCTCATGC -3'
(R):5'- atccacctgcctctgcc -3'
Posted On2013-04-11