Incidental Mutation 'R1927:Kdm4c'
ID214937
Institutional Source Beutler Lab
Gene Symbol Kdm4c
Ensembl Gene ENSMUSG00000028397
Gene Namelysine (K)-specific demethylase 4C
SynonymsJmjd2c, 2410141F18Rik
MMRRC Submission 039945-MU
Accession Numbers

Genbank: NM_001172095; MGI: 1924054

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1927 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location74242497-74405860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74345483 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 668 (T668I)
Ref Sequence ENSEMBL: ENSMUSP00000077017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030102] [ENSMUST00000077851]
Predicted Effect probably benign
Transcript: ENSMUST00000030102
AA Change: T668I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030102
Gene: ENSMUSG00000028397
AA Change: T668I

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077851
AA Change: T668I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077017
Gene: ENSMUSG00000028397
AA Change: T668I

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family. The encoded protein is a trimethylation-specific demethylase, and converts specific trimethylated histone residues to the dimethylated form. This enzymatic action regulates gene expression and chromosome segregation. Chromosomal aberrations and changes in expression of this gene may be found in tumor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null gene trap allele cannot be produced likely due to embryonic lethality. Mice heterozygous for a null gene trap allele exhibit reduced body weight and lower incidence and multiplicity of both benign and malignant tumors in mice treated with DMBA and TPA. [provided by MGI curators]
Allele List at MGI

All alleles(402) : Targeted, other(2) Gene trapped(400)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Dyx1c1 A T 9: 72,960,627 I57L probably damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Eml1 C T 12: 108,538,217 R812* probably null Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr1463 T C 19: 13,235,029 Y260H probably damaging Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Rtp1 T A 16: 23,431,209 I108N probably damaging Het
Sema6b A T 17: 56,132,797 F15I probably benign Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc22a29 A G 19: 8,207,066 I257T probably benign Het
Slc41a1 T C 1: 131,841,200 I256T probably damaging Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sorcs1 G T 19: 50,222,195 P744Q probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stat3 T C 11: 100,894,829 N465S probably damaging Het
Stmn2 T A 3: 8,545,576 M40K probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Znrf3 A G 11: 5,281,062 V817A probably benign Het
Other mutations in Kdm4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Kdm4c APN 4 74345501 missense probably benign 0.19
IGL00225:Kdm4c APN 4 74345567 missense probably benign 0.03
IGL00672:Kdm4c APN 4 74343514 missense probably benign 0.00
IGL00897:Kdm4c APN 4 74373684 missense probably damaging 1.00
IGL01479:Kdm4c APN 4 74343501 missense probably benign 0.18
IGL01707:Kdm4c APN 4 74336927 missense probably damaging 1.00
IGL02142:Kdm4c APN 4 74307016 critical splice donor site probably null
IGL02268:Kdm4c APN 4 74373716 missense possibly damaging 0.94
IGL02662:Kdm4c APN 4 74404821 missense probably damaging 0.99
IGL03377:Kdm4c APN 4 74271255 missense possibly damaging 0.82
3-1:Kdm4c UTSW 4 74334673 missense probably benign 0.00
BB002:Kdm4c UTSW 4 74404821 missense probably damaging 0.99
BB012:Kdm4c UTSW 4 74404821 missense probably damaging 0.99
PIT4434001:Kdm4c UTSW 4 74271332 missense probably benign 0.01
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0219:Kdm4c UTSW 4 74373620 missense probably damaging 1.00
R0309:Kdm4c UTSW 4 74345567 missense probably benign 0.00
R0512:Kdm4c UTSW 4 74333794 missense probably benign
R1070:Kdm4c UTSW 4 74373628 nonsense probably null
R1518:Kdm4c UTSW 4 74333826 missense probably benign
R1713:Kdm4c UTSW 4 74298484 missense probably benign 0.10
R1769:Kdm4c UTSW 4 74280997 missense possibly damaging 0.66
R1962:Kdm4c UTSW 4 74307016 intron probably benign
R1992:Kdm4c UTSW 4 74343394 missense possibly damaging 0.71
R2389:Kdm4c UTSW 4 74333870 critical splice donor site probably null
R2979:Kdm4c UTSW 4 74373728 nonsense probably null
R3966:Kdm4c UTSW 4 74298583 missense probably damaging 1.00
R4094:Kdm4c UTSW 4 74311678 missense probably benign
R4171:Kdm4c UTSW 4 74280898 missense possibly damaging 0.73
R4543:Kdm4c UTSW 4 74330760 missense probably benign 0.01
R4581:Kdm4c UTSW 4 74357339 splice site probably null
R5019:Kdm4c UTSW 4 74343535 missense probably damaging 1.00
R5088:Kdm4c UTSW 4 74334699 missense probably benign
R5533:Kdm4c UTSW 4 74315649 intron probably benign
R5663:Kdm4c UTSW 4 74399348 missense probably damaging 1.00
R5691:Kdm4c UTSW 4 74334728 missense probably benign
R5775:Kdm4c UTSW 4 74359431 missense probably damaging 1.00
R5786:Kdm4c UTSW 4 74359485 missense probably damaging 0.98
R6002:Kdm4c UTSW 4 74404969 missense possibly damaging 0.95
R6375:Kdm4c UTSW 4 74330715 missense probably damaging 0.96
R6491:Kdm4c UTSW 4 74373636 missense probably damaging 1.00
R6790:Kdm4c UTSW 4 74391461 missense probably damaging 1.00
R6952:Kdm4c UTSW 4 74357350 missense probably damaging 1.00
R7157:Kdm4c UTSW 4 74345567 missense probably benign 0.01
R7319:Kdm4c UTSW 4 74336963 missense probably damaging 1.00
R7925:Kdm4c UTSW 4 74404821 missense probably damaging 0.99
R7976:Kdm4c UTSW 4 74377669 missense probably damaging 0.99
R7990:Kdm4c UTSW 4 74391448 missense probably damaging 1.00
R8185:Kdm4c UTSW 4 74373584 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGAACACTGGTGAAATGC -3'
(R):5'- ATCTGACGTATTTACTTGCATGAACCC -3'

Sequencing Primer
(F):5'- CACTGGTGAAATGCTACCAATTG -3'
(R):5'- ATTTACTTGCATGAACCCGCACG -3'
Posted On2014-07-14